Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31359
Trapped Gene
Nicn1 (ENSMUSG00000032606)
Vector Insertion
Chr 9: 108197325 - 108197398
Public Clones IST13955B1 (tigm) IST11057F6 (tigm) IST15083E6 (tigm) IST11057F6 (tigm)
IST13606B9 (tigm) IST13404B4 (tigm) IST15083E6 (tigm) IST13728F4 (tigm)
IST13404B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221505 (Chr9:108197220..108197324 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGGGCTAGTCACACTTCC Chr9:108197284..108197303 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221505 (Chr9:108197220..108197324 +)
Downstram Exon
ENSMUSE00000392675 (Chr9:108197399..108198829 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGGGCTAGTCACACTTCC Chr9:108197284..108197303 60.26 55 AACTTGGATGCACAGGGAAC Chr9:108197530..108197549 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221508 Chr9:108192779..108192993 TAAGGGACGCCAATAAGAGC Chr9:108192785..108192804 59.32 50
upstream ENSMUSE00000221504 Chr9:108195667..108195843 ACAGCAGCCAAGTGGGTAAC Chr9:108195742..108195761 60.18 55
upstream ENSMUSE00000221503 Chr9:108196262..108196375 TGAACAGAGTGCTGGAGCTG Chr9:108196275..108196294 60.33 55
upstream ENSMUSE00000221507 Chr9:108196777..108196848 ACCCAGTGTCCAATGAGCAG Chr9:108196811..108196830 61.13 55
upstream ENSMUSE00000221505 Chr9:108197220..108197324 TTCGGGCTAGTCACACTTCC Chr9:108197284..108197303 60.26 55

*** Putative Vector Insertion (Chr 9: 108197325 - 108197398) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000392675 Chr9:108197399..108198829 AACTTGGATGCACAGGGAAC Chr9:108197530..108197549 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTGCTTCCATCACTTTG Chr9:108197346..108197366 60.63 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTTGCTTCCATCACTTTG Chr9:108197346..108197366 60.63 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032606