Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31366
Trapped Gene
Ttf1 (ENSMUSG00000026803)
Vector Insertion
Chr 2: 28930329 - 28934908
Public Clones 3SE223F09 (ggtc) (cmhd) IST15061H12 (tigm) IST14429B1 (tigm) IST11733F2 (tigm)
IST12081F5 (tigm) IST11048G3 (tigm) IST12080F5 (tigm) IST12080F5 (tigm)
IST10702H12 (tigm) IST10277B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697163 (Chr2:28930094..28930328 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCTAATCAAGGCTGTGG Chr2:28930131..28930150 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697163 (Chr2:28930094..28930328 +)
Downstram Exon
ENSMUSE00000697162 (Chr2:28934909..28934998 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCTAATCAAGGCTGTGG Chr2:28930131..28930150 59.84 55 ACGATACACGAACCCACCAT Chr2:28934960..28934979 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000604672 Chr2:28915783..28915823 GGAAGACGAGCGCTACATTG Chr2:28915797..28915816 60.93 55
upstream ENSMUSE00000697175 Chr2:28920139..28921428 CCAGGAGAACTCGGAGAGTG Chr2:28920544..28920563 59.98 60
upstream ENSMUSE00000464537 Chr2:28920146..28920481 TCTCAGTGCTTGGAGAGCAA Chr2:28920245..28920264 59.85 50
upstream ENSMUSE00000467207 Chr2:28920557..28921428 GGCTTGTTCCACTGAGAAGC Chr2:28921390..28921409 60 55
upstream ENSMUSE00000717651 Chr2:28922523..28922749 CAGTGAGACAGCTGCGAGAG Chr2:28922639..28922658 60.07 60
upstream ENSMUSE00000721255 Chr2:28922523..28922749 CAGTGAGACAGCTGCGAGAG Chr2:28922639..28922658 60.07 60
upstream ENSMUSE00000162972 Chr2:28925412..28925597 ACCAACCTAAAACGGAAGCA Chr2:28925558..28925577 59.61 45
upstream ENSMUSE00000697166 Chr2:28925412..28925597 ACCAACCTAAAACGGAAGCA Chr2:28925558..28925577 59.61 45
upstream ENSMUSE00000162970 Chr2:28926818..28926896 GCTCGTGTACTACCGTGCAA Chr2:28926843..28926862 59.94 55
upstream ENSMUSE00000697165 Chr2:28926818..28926896 GCTCGTGTACTACCGTGCAA Chr2:28926843..28926862 59.94 55
upstream ENSMUSE00000162960 Chr2:28929409..28929539 CAGTCGCCCTCAAGTTCTCT Chr2:28929507..28929526 59.6 55
upstream ENSMUSE00000697164 Chr2:28929409..28929539 CAGTCGCCCTCAAGTTCTCT Chr2:28929507..28929526 59.6 55
upstream ENSMUSE00000162954 Chr2:28930094..28930328 GAGGCTAATCAAGGCTGTGG Chr2:28930131..28930150 59.84 55
upstream ENSMUSE00000697163 Chr2:28930094..28930328 GAGGCTAATCAAGGCTGTGG Chr2:28930131..28930150 59.84 55

*** Putative Vector Insertion (Chr 2: 28930329 - 28934908) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162968 Chr2:28934909..28934998 ACGATACACGAACCCACCAT Chr2:28934960..28934979 60.12 50
downstream ENSMUSE00000697162 Chr2:28934909..28934998 ACGATACACGAACCCACCAT Chr2:28934960..28934979 60.12 50
downstream ENSMUSE00000162971 Chr2:28936532..28936597 No primer for this exon
downstream ENSMUSE00000697161 Chr2:28936532..28936597 No primer for this exon
downstream ENSMUSE00000162962 Chr2:28939053..28939138 GCAGGCAGCTTTCAGCTTAT Chr2:28939110..28939129 59.76 50
downstream ENSMUSE00000697160 Chr2:28939053..28939138 GCAGGCAGCTTTCAGCTTAT Chr2:28939110..28939129 59.76 50
downstream ENSMUSE00000646288 Chr2:28940157..28940334 TCATCGCAATGGAAGATGTC Chr2:28940304..28940323 59.61 45
downstream ENSMUSE00000646289 Chr2:28940157..28940334 TCATCGCAATGGAAGATGTC Chr2:28940304..28940323 59.61 45
downstream ENSMUSE00000646287 Chr2:28941627..28943169 CAGCAGTATATGGGCGGTTT Chr2:28942353..28942372 59.98 50
downstream ENSMUSE00000697168 Chr2:28941627..28943169 CAGCAGTATATGGGCGGTTT Chr2:28942353..28942372 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGAGGCTTCCTGTGTACG Chr2:28930335..28930355 59.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGAGGCTTCCTGTGTACG Chr2:28930335..28930355 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026803