Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31373
Trapped Gene
Keg1 (ENSMUSG00000024694)
Vector Insertion
Chr 19: 12785580 - 12788996
Public Clones IST14092H1 (tigm) IST13821F1 (tigm) IST14043A5 (tigm) IST12003D7 (tigm)
IST14166F9 (tigm) IST13857F8 (tigm) IST14023F1 (tigm) IST11914B6 (tigm)
IST15034B5 (tigm) IST11413G7 (tigm) IST13857D7 (tigm) IST13799D11 (tigm)
IST14366A11 (tigm) IST13857B6 (tigm) IST13258H3 (tigm) IST10220F3 (tigm)
IST12147C10 (tigm) IST13064A12 (tigm) IST13857A8 (tigm) IST13821E10 (tigm)
IST13799A2 (tigm) IST13857D5 (tigm) IST12108C2 (tigm) IST13857B8 (tigm)
IST13799B2 (tigm) IST13857C8 (tigm) IST13904D10 (tigm) IST13857A5 (tigm)
IST14922E7 (tigm) IST14384F11 (tigm) IST13821D10 (tigm) IST13801F1 (tigm)
IST13223H10 (tigm) IST10763G11 (tigm) IST12003D7 (tigm) IST10997C9 (tigm)
IST13857G7 (tigm) IST15085B10 (tigm) IST13857A4 (tigm) IST10016G8 (tigm)
IST11703A1 (tigm) IST11274E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000461151 (Chr19:12785472..12785579 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTATTCGACCCCAGGAAG Chr19:12785558..12785577 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000461151 (Chr19:12785472..12785579 +)
Downstram Exon
ENSMUSE00000514465 (Chr19:12788997..12789123 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTATTCGACCCCAGGAAG Chr19:12785558..12785577 59.93 50 ACAGTGCTTGGGATCCTTTG Chr19:12789068..12789087 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369185 Chr19:12770283..12770331 AAGCTCTCTGTGTGGATACGG Chr19:12770303..12770323 59.37 52.38
upstream ENSMUSE00000144421 Chr19:12784087..12784176 AAGGAAGCACCTCCCTGAGT Chr19:12784149..12784168 60.25 55
upstream ENSMUSE00000461151 Chr19:12785472..12785579 TGTTATTCGACCCCAGGAAG Chr19:12785558..12785577 59.93 50

*** Putative Vector Insertion (Chr 19: 12785580 - 12788996) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000514465 Chr19:12788997..12789123 ACAGTGCTTGGGATCCTTTG Chr19:12789068..12789087 60.11 50
downstream ENSMUSE00000144422 Chr19:12790388..12790559 CCCAAGTTAGTGGCTCCAAG Chr19:12790445..12790464 59.73 55
downstream ENSMUSE00000401356 Chr19:12793270..12794384 AAGGGGAGTGCAGGATAGGT Chr19:12794019..12794038 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTATTCGACCCCAGGAAG Chr19:12788559..12788579 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTTAGGGTGCGTGACTG Chr19:12788619..12788639 58.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024694