Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3139
Trapped Gene
Tbc1d10a (ENSMUSG00000034412)
Vector Insertion
Chr 11: 4110037 - 4112143
Public Clones XR0234 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398750 (Chr11:4109929..4110036 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAACCCTGGGAAGTTTGA Chr11:4110016..4110035 60.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398750 (Chr11:4109929..4110036 +)
Downstram Exon
ENSMUSE00000310432 (Chr11:4112144..4112250 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAACCCTGGGAAGTTTGA Chr11:4110016..4110035 60.08 50 CAGGTCACGCTCAATCACAT Chr11:4112203..4112222 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000310451 Chr11:4086792..4087102 CATCGACAAGTTCGGATTCA Chr11:4087055..4087074 59.65 45
upstream ENSMUSE00000310447 Chr11:4105760..4105859 TGCTCAACAACTGGGACAAA Chr11:4105816..4105835 60.28 45
upstream ENSMUSE00000398750 Chr11:4109929..4110036 CAGAACCCTGGGAAGTTTGA Chr11:4110016..4110035 60.08 50

*** Putative Vector Insertion (Chr 11: 4110037 - 4112143) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310432 Chr11:4112144..4112250 CAGGTCACGCTCAATCACAT Chr11:4112203..4112222 59.71 50
downstream ENSMUSE00000310426 Chr11:4112788..4112902 CTTCAGCACACGGAACAGGT Chr11:4112818..4112837 61.31 55
downstream ENSMUSE00000310422 Chr11:4112981..4113046 AGCCAGGCAGGTACTTCTCA Chr11:4113032..4113051 60.01 55
downstream ENSMUSE00000310418 Chr11:4113560..4113749 TCATGTACAGCAGGGGATCA Chr11:4113671..4113690 60.07 50
downstream ENSMUSE00000310413 Chr11:4113840..4113994 CCCAGTGCATGCTTCAGTAG Chr11:4113894..4113913 59.47 55
downstream ENSMUSE00000395623 Chr11:4114704..4115505 TGGACCAGCCAGATCCTATC Chr11:4115292..4115311 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGAACCCTGGGAAGTTT Chr11:4110015..4110035 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGAACCCTGGGAAGTTT Chr11:4110015..4110035 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034412