Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31406
Trapped Gene
Giyd2 (ENSMUSG00000059772)
Vector Insertion
Chr 7: 133836266 - 133839250
Public Clones IST13042H12 (tigm) IST10456D10 (tigm) IST11834H10 (tigm) IST10987A12 (tigm)
IST12126B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000467722 (Chr7:133838939..133839249 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCCCGTGCTTTTTCCTAA Chr7:133839213..133839232 59.82 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000467722 (Chr7:133838939..133839249 -)
Downstram Exon
ENSMUSE00000527212 (Chr7:133836267..133836318 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCCCGTGCTTTTTCCTAA Chr7:133839213..133839232 59.82 45 ACCGTGTATGATCAGCACCA Chr7:133836272..133836291 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000467722 Chr7:133838939..133839249 TCTCCCGTGCTTTTTCCTAA Chr7:133839213..133839232 59.82 45
upstream ENSMUSE00000527212 Chr7:133836267..133836318 GGTGCTGATCATACACGGTTT Chr7:133836292..133836312 59.87 47.62

*** Putative Vector Insertion (Chr 7: 133836266 - 133839250) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000425284 Chr7:133835835..133836173 TGGTCGTTTTGGGACTAAGG Chr7:133835894..133835913 59.96 50
downstream ENSMUSE00000425274 Chr7:133835442..133835569 CCTCTGCCAAGCAGATGATA Chr7:133835475..133835494 58.98 50
downstream ENSMUSE00000351201 Chr7:133835253..133835337 CAACCAGGTTTCCCCAAAGT Chr7:133835281..133835300 61.13 50
downstream ENSMUSE00000527211 Chr7:133834192..133835169 TCCAGCAAGTCTGTCCAGTG Chr7:133835125..133835144 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTCCCGTGCTTTTTCCTA Chr7:133839212..133839232 59.82 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTCTCCCGTGCTTTTTCCT Chr7:133839213..133839233 60.07 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059772