Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31416
Trapped Gene
Pard6a (ENSMUSG00000005699)
Vector Insertion
Chr 8: 108225704 - 108226073
Public Clones IST14385C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343862 (Chr8:108225571..108225703 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343862 (Chr8:108225571..108225703 +)
Downstram Exon
ENSMUSE00000228821 (Chr8:108226074..108226296 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679931 Chr8:108225054..108225217 No primer for this exon
upstream ENSMUSE00000343862 Chr8:108225571..108225703 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108225704 - 108226073) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000228821 Chr8:108226074..108226296 No primer for this exon
downstream ENSMUSE00000580340 Chr8:108226508..108227393 No primer for this exon
downstream ENSMUSE00000706337 Chr8:108226508..108227262 No primer for this exon
downstream ENSMUSE00000706338 Chr8:108226511..108227393 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTAATCGCCTTGCAGCAC Chr8:108225752..108225772 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTAGGGCTCCTAATCGTGA Chr8:108225740..108225760 59.43 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005699