Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31419
Trapped Gene
Spire1 (ENSMUSG00000024533)
Vector Insertion
Chr 18: 67672494 - 67679075
Public Clones IST13296H12 (tigm) IST12723G12 (tigm) IST14092E6 (tigm) IST11628G7 (tigm)
IST12781E8 (tigm) IST12869B3 (tigm) IST10496D6 (tigm) IST12659C10 (tigm)
IST14910A8 (tigm) IST12723G12 (tigm) IST12504E8 (tigm) IST13489C5 (tigm)
IST11814B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709274 (Chr18:67678945..67679074 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCTTCGACCTGTGTCACC Chr18:67678971..67678990 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709274 (Chr18:67678945..67679074 -)
Downstram Exon
ENSMUSE00000701545 (Chr18:67672495..67672533 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCTTCGACCTGTGTCACC Chr18:67678971..67678990 60.31 55 CAAGTCAAAACTGTGAGACATGC Chr18:67672477..67672499 59.83 43.48

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000572268 Chr18:67770059..67770443 GAGATCCTGCGGCTCTACAA Chr18:67770253..67770272 60.5 55
upstream ENSMUSE00000572267 Chr18:67747479..67747513 No primer for this exon
upstream ENSMUSE00000572256 Chr18:67712228..67712375 CCGGTCCTATCAGGACGTTA Chr18:67712233..67712252 59.95 55
upstream ENSMUSE00000572266 Chr18:67712228..67712461 CCGGTCCTATCAGGACGTTA Chr18:67712233..67712252 59.95 55
upstream ENSMUSE00000701549 Chr18:67708778..67708827 No primer for this exon
upstream ENSMUSE00000457637 Chr18:67705269..67705394 GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60
upstream ENSMUSE00000701548 Chr18:67705269..67705394 GCTCACCTCCCAACTGAGTC Chr18:67705366..67705385 59.84 60
upstream ENSMUSE00000143108 Chr18:67690061..67690138 GGAGGACCTGAAAAATGCAG Chr18:67690066..67690085 59.67 50
upstream ENSMUSE00000143125 Chr18:67688518..67688682 TTTGCGAAATGGGGTAAAAC Chr18:67688634..67688653 59.81 40
upstream ENSMUSE00000314225 Chr18:67679458..67679544 CCTCGGTTGAAAAAGAGTGC Chr18:67679507..67679526 59.85 50
upstream ENSMUSE00000709274 Chr18:67678945..67679074 AAGCTTCGACCTGTGTCACC Chr18:67678971..67678990 60.31 55
upstream ENSMUSE00000721234 Chr18:67678945..67679074 AAGCTTCGACCTGTGTCACC Chr18:67678971..67678990 60.31 55
upstream ENSMUSE00000572255 Chr18:67672495..67672533 No primer for this exon
upstream ENSMUSE00000701545 Chr18:67672495..67672533 No primer for this exon

*** Putative Vector Insertion (Chr 18: 67672494 - 67679075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000625262 Chr18:67666208..67666380 TGGAGATTCTGGCGTAGTGA Chr18:67666336..67666355 59.39 50
downstream ENSMUSE00000701544 Chr18:67666208..67666380 TGGAGATTCTGGCGTAGTGA Chr18:67666336..67666355 59.39 50
downstream ENSMUSE00000625261 Chr18:67665305..67665398 GCTGGTTGACTTGTGCAGAC Chr18:67665347..67665366 59.47 55
downstream ENSMUSE00000701543 Chr18:67665305..67665398 GCTGGTTGACTTGTGCAGAC Chr18:67665347..67665366 59.47 55
downstream ENSMUSE00000625260 Chr18:67663085..67663227 GCCTCACGTTCGTAGGTGTT Chr18:67663101..67663120 60.18 55
downstream ENSMUSE00000701540 Chr18:67663085..67663227 GCCTCACGTTCGTAGGTGTT Chr18:67663101..67663120 60.18 55
downstream ENSMUSE00000572261 Chr18:67660722..67660895 CCACCTGCTGGTAAAAGCTC Chr18:67660712..67660731 59.88 55
downstream ENSMUSE00000625259 Chr18:67656831..67656968 AGCTCTGCTTTCACCAGGAC Chr18:67656861..67656880 59.6 55
downstream ENSMUSE00000701539 Chr18:67656831..67656968 AGCTCTGCTTTCACCAGGAC Chr18:67656861..67656880 59.6 55
downstream ENSMUSE00000625258 Chr18:67656216..67656286 GTTCGGCAACAGAAGCAGAG Chr18:67656245..67656264 61.12 55
downstream ENSMUSE00000701538 Chr18:67656216..67656286 GTTCGGCAACAGAAGCAGAG Chr18:67656245..67656264 61.12 55
downstream ENSMUSE00000625257 Chr18:67655017..67655044 No primer for this exon
downstream ENSMUSE00000701536 Chr18:67655017..67655044 No primer for this exon
downstream ENSMUSE00000625256 Chr18:67654794..67654930 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50
downstream ENSMUSE00000701533 Chr18:67654794..67654930 ATACTTCGAAGAGGCCGATG Chr18:67654778..67654797 59.29 50
downstream ENSMUSE00000659122 Chr18:67647867..67651203 GAAACTGGAGCTCCTCATCG Chr18:67651129..67651148 59.95 55
downstream ENSMUSE00000659123 Chr18:67647863..67651203 GAAACTGGAGCTCCTCATCG Chr18:67651129..67651148 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGATAATCGCCTTGCAGCAC Chr18:67676007..67676028 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTTCAAGGTTTCAGCCAGA Chr18:67676061..67676082 59.48 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024533