Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31425
Trapped Gene
Tmem62 (ENSMUSG00000054484)
Vector Insertion
Chr 2: 120806255 - 120810069
Public Clones IST14933E7 (tigm) IST14770G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435505 (Chr2:120806209..120806254 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGAGCATCGCCAATTAT Chr2:120806230..120806249 60.57 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435505 (Chr2:120806209..120806254 +)
Downstram Exon
ENSMUSE00000435498 (Chr2:120810070..120810211 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGAGCATCGCCAATTAT Chr2:120806230..120806249 60.57 45 TAGTTGCCAAAGGGAGTGCT Chr2:120810138..120810157 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435543 Chr2:120802798..120803214 CCCTGCTGTTGGAGCACTAC Chr2:120803093..120803112 60.85 60
upstream ENSMUSE00000684942 Chr2:120803269..120803546 GGGTTCGTTAGGGCATCTTT Chr2:120803316..120803335 60.32 50
upstream ENSMUSE00000435522 Chr2:120803435..120803546 GACATCATTCAACCGGCTCT Chr2:120803513..120803532 60.08 50
upstream ENSMUSE00000435513 Chr2:120804867..120805004 TTGGGATCCAGACAACATGA Chr2:120804899..120804918 59.89 45
upstream ENSMUSE00000684941 Chr2:120804867..120805004 TTGGGATCCAGACAACATGA Chr2:120804899..120804918 59.89 45
upstream ENSMUSE00000435505 Chr2:120806209..120806254 TGGAGAGCATCGCCAATTAT Chr2:120806230..120806249 60.57 45

*** Putative Vector Insertion (Chr 2: 120806255 - 120810069) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435498 Chr2:120810070..120810211 TAGTTGCCAAAGGGAGTGCT Chr2:120810138..120810157 59.88 50
downstream ENSMUSE00000435493 Chr2:120812319..120812443 ACCAAATCGTCTGGTTGCTC Chr2:120812385..120812404 60.12 50
downstream ENSMUSE00000434960 Chr2:120812572..120812694 AGGTGCCCACACAGATAAGC Chr2:120812604..120812623 60.14 55
downstream ENSMUSE00000434956 Chr2:120816067..120816222 CTTTCTAGCGGCTCATGCTT Chr2:120816201..120816220 59.75 50
downstream ENSMUSE00000434955 Chr2:120819214..120819373 CCTGGCCTATATCACCTCCA Chr2:120819287..120819306 59.91 55
downstream ENSMUSE00000434951 Chr2:120822142..120822255 TGATGCCAAAGGATCAAATG Chr2:120822228..120822247 59.47 40
downstream ENSMUSE00000434949 Chr2:120824810..120824894 TGAGCTGGATCAGCACAATC Chr2:120824852..120824871 59.95 50
downstream ENSMUSE00000434946 Chr2:120828233..120828337 No primer for this exon
downstream ENSMUSE00000434944 Chr2:120830418..120830536 ATGAAAAGCAGCAACCCAAT Chr2:120830474..120830493 59.57 40
downstream ENSMUSE00000435533 Chr2:120832555..120833569 TGACCAAAGCAGCGATGTAG Chr2:120832625..120832644 60.01 50
downstream ENSMUSE00000684940 Chr2:120832555..120833380 TGACCAAAGCAGCGATGTAG Chr2:120832625..120832644 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCTTCACTTGGTGACTTT Chr2:120809222..120809242 59.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGAGAGCATCGCCAATTA Chr2:120809230..120809250 61.27 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054484