Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31431
Trapped Gene
AC186378.2-203 (ENSMUSG00000079404)
Vector Insertion
Chr 14: 3618271 - 3648881
Public Clones IST10267G10 (tigm) IST14860A9 (tigm) IST10787E1 (tigm) IST11186F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693238 (Chr14:3618077..3618270 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGAGGATTCGTCCAACAG Chr14:3618181..3618200 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693238 (Chr14:3618077..3618270 +)
Downstram Exon
ENSMUSE00000693236 (Chr14:3648882..3650049 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGAGGATTCGTCCAACAG Chr14:3618181..3618200 59.65 55 CTGGGGAAGCACCATACACT Chr14:3649857..3649876 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693240 Chr14:3609811..3609975 TTGGTTTTGCCAGAAAGAGG Chr14:3609903..3609922 60.22 45
upstream ENSMUSE00000693239 Chr14:3617309..3617483 GATGGGCGCTTTAGAATCAC Chr14:3617317..3617336 59.67 50
upstream ENSMUSE00000693238 Chr14:3618077..3618270 GGAGAGGATTCGTCCAACAG Chr14:3618181..3618200 59.65 55

*** Putative Vector Insertion (Chr 14: 3618271 - 3648881) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693236 Chr14:3648882..3650049 CTGGGGAAGCACCATACACT Chr14:3649857..3649876 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGACTAATCGCCTTGCAG Chr14:3624316..3624336 60.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGAGACTACAGGGCGTGA Chr14:3621306..3621327 59.92 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079404