Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31432
Trapped Gene
Alkbh8 (ENSMUSG00000025899)
Vector Insertion
Chr 9: 3349491 - 3359483
Public Clones IST12572E7 (tigm) IST14598G8 (tigm) IST10267G10 (tigm) IST12308B12 (tigm)
IST14860A9 (tigm) IST10536D5 (tigm) IST12291D6 (tigm) IST11186F9 (tigm)
IST10294C5 (tigm) IST10787E1 (tigm) IST13914F10 (tigm) IST14541A4 (tigm)
IST10409F5 (tigm) IST13434A7 (tigm) IST12685B11 (tigm) IST10387E8 (tigm)
IST10349A9 (tigm) IST13682G9 (tigm) IST14452F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457033 (Chr9:3349420..3349490 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGACACGCATTCTGCATT Chr9:3349434..3349453 59.16 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457033 (Chr9:3349420..3349490 +)
Downstram Exon
ENSMUSE00000457027 (Chr9:3359484..3359590 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGACACGCATTCTGCATT Chr9:3349434..3349453 59.16 40 AGCAAACTCCGACGAGGTAA Chr9:3359554..3359573 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000384764 Chr9:3335478..3335594 CAGCTGGGAGGTGAACATTT Chr9:3335572..3335591 60.11 50
upstream ENSMUSE00000153944 Chr9:3338456..3338591 AAGGCATCCAAGCAGTGTCT Chr9:3338560..3338579 59.87 50
upstream ENSMUSE00000153943 Chr9:3343015..3343252 GTCTGGGTAATGGCGTGAGT Chr9:3343037..3343056 60 55
upstream ENSMUSE00000457045 Chr9:3344588..3344719 CAGGCCTCTTGGTGGTAGAA Chr9:3344624..3344643 60.25 55
upstream ENSMUSE00000457040 Chr9:3345781..3345876 No primer for this exon
upstream ENSMUSE00000457035 Chr9:3347804..3347908 TCCTGAGGTTTGCAGTAGCA Chr9:3347808..3347827 59.59 50
upstream ENSMUSE00000457033 Chr9:3349420..3349490 ATTGACACGCATTCTGCATT Chr9:3349434..3349453 59.16 40

*** Putative Vector Insertion (Chr 9: 3349491 - 3359483) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457027 Chr9:3359484..3359590 AGCAAACTCCGACGAGGTAA Chr9:3359554..3359573 59.88 50
downstream ENSMUSE00000457025 Chr9:3367864..3368015 CTCAGACGCTTGGACGGTAT Chr9:3367906..3367925 60.28 55
downstream ENSMUSE00000153963 Chr9:3369658..3369914 TTGTCTGTCGCAGACTGAGG Chr9:3369686..3369705 60.18 55
downstream ENSMUSE00000340659 Chr9:3382694..3382843 TGGTGAATGACGGCAATAGA Chr9:3382833..3382852 60.07 45
downstream ENSMUSE00000378203 Chr9:3385042..3387050 TGTTCCATTGCCCAGACATA Chr9:3385130..3385149 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAACTGGTTAATGGCAGGA Chr9:3355521..3355542 59.99 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTCGTGACTGGGAAAACC Chr9:3358537..3358558 60.21 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025899