Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31433
Trapped Gene
Dhdh (ENSMUSG00000011382)
Vector Insertion
Chr 7: 52730974 - 52734504
Public Clones IST12375C9 (tigm) IST12375D9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000203806 (Chr7:52734379..52734503 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000203806 (Chr7:52734379..52734503 -)
Downstram Exon
ENSMUSE00000203814 (Chr7:52730975..52731122 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344844 Chr7:52744044..52744166 No primer for this exon
upstream ENSMUSE00000203813 Chr7:52743430..52743541 No primer for this exon
upstream ENSMUSE00000203807 Chr7:52742111..52742274 No primer for this exon
upstream ENSMUSE00000203811 Chr7:52737159..52737411 No primer for this exon
upstream ENSMUSE00000203806 Chr7:52734379..52734503 No primer for this exon
upstream ENSMUSE00000203814 Chr7:52730975..52731122 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52730974 - 52734504) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000350626 Chr7:52728933..52730745 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCTGACTTGTGCCTTCT Chr7:52731508..52731528 59.45 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTATCCAGGAGGGGTTCA Chr7:52734453..52734473 59.92 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011382