Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31436
Trapped Gene
Prdm14 (ENSMUSG00000042414)
Vector Insertion
Chr 1: 13103508 - 13105963
Public Clones IST15037F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316395 (Chr1:13105861..13105962 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTGAACAAGCACATGAGA Chr1:13105906..13105925 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316395 (Chr1:13105861..13105962 -)
Downstram Exon
ENSMUSE00000630774 (Chr1:13103509..13104568 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTGAACAAGCACATGAGA Chr1:13105906..13105925 59.99 50 GCACATAGTCGCTGGCTACA Chr1:13104056..13104075 60.04 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702730 Chr1:13117191..13117244 No primer for this exon
upstream ENSMUSE00000316434 Chr1:13115247..13115937 TCCCGAAGTACCACGATTTC Chr1:13115580..13115599 59.93 50
upstream ENSMUSE00000316429 Chr1:13114700..13114753 CAAAGACTCCCTCCAGCTTC Chr1:13114706..13114725 59.01 55
upstream ENSMUSE00000316422 Chr1:13114444..13114601 AGGGACAACTCTCGGATGTG Chr1:13114448..13114467 60.11 55
upstream ENSMUSE00000316412 Chr1:13112442..13112712 TTTATCGACGGCAAAGGTTC Chr1:13112666..13112685 60.07 45
upstream ENSMUSE00000316401 Chr1:13108844..13109046 GAACGCTGTGGAAAGGTGTT Chr1:13109004..13109023 60.16 50
upstream ENSMUSE00000702728 Chr1:13106362..13106364 No primer for this exon
upstream ENSMUSE00000316395 Chr1:13105861..13105962 GCCTGAACAAGCACATGAGA Chr1:13105906..13105925 59.99 50
upstream ENSMUSE00000630774 Chr1:13103509..13104568 TGTAGCCAGCGACTATGTGC Chr1:13104078..13104097 60.04 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACAAGCTAATCGCCTTGC Chr1:13105900..13105920 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTCTTCCAGCCTGAACAA Chr1:13105914..13105934 59.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042414