Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31443
Trapped Gene
Bbs2 (ENSMUSG00000031755)
Vector Insertion
Chr 8: 96606255 - 96610643
Public Clones IST11865B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212702 (Chr8:96610556..96610642 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACTGATAACCGGGTGGT Chr8:96610567..96610586 60.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212702 (Chr8:96610556..96610642 -)
Downstram Exon
ENSMUSE00000212705 (Chr8:96606256..96606391 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACTGATAACCGGGTGGT Chr8:96610567..96610586 60.23 50 TAACTGTACGTGGCCATCCA Chr8:96606259..96606278 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362772 Chr8:96622136..96622711 GCAGGCGTAGAGAGAGTTGG Chr8:96622423..96622442 60.16 60
upstream ENSMUSE00000298759 Chr8:96616295..96616522 AACCCTGAGCTTGGCTATGA Chr8:96616371..96616390 59.84 50
upstream ENSMUSE00000212708 Chr8:96613662..96613787 ATCGGTGGAAACTGTGCTCT Chr8:96613702..96613721 59.73 50
upstream ENSMUSE00000212721 Chr8:96613003..96613065 ACTTTGACGGTGATGGGAAG Chr8:96613009..96613028 59.97 50
upstream ENSMUSE00000212730 Chr8:96611277..96611354 TTGTGGCAGAAATGACAGAGA Chr8:96611282..96611302 59.43 42.86
upstream ENSMUSE00000212704 Chr8:96610731..96610835 ATGGCAGTCGGTTTGGTTAC Chr8:96610791..96610810 59.86 50
upstream ENSMUSE00000212702 Chr8:96610556..96610642 TGAACTGATAACCGGGTGGT Chr8:96610567..96610586 60.23 50
upstream ENSMUSE00000212705 Chr8:96606256..96606391 TGGATGGCCACGTACAGTTA Chr8:96606281..96606300 59.99 50

*** Putative Vector Insertion (Chr 8: 96606255 - 96610643) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212710 Chr8:96605898..96606037 CTCAGCTCTCGGATCAGGTC Chr8:96605931..96605950 60.1 60
downstream ENSMUSE00000212703 Chr8:96604925..96605069 GCTGGGATTATGCCTTTCTG Chr8:96604992..96605011 59.67 50
downstream ENSMUSE00000212718 Chr8:96604668..96604839 GCTTCTGTAACCCACGAAGG Chr8:96604648..96604667 59.73 55
downstream ENSMUSE00000298687 Chr8:96603383..96603512 CTGGGCTTGTCAATGCATAC Chr8:96603420..96603439 59.15 50
downstream ENSMUSE00000212728 Chr8:96600852..96600983 ACCATTGCGTAACGATGTGA Chr8:96600866..96600885 59.99 45
downstream ENSMUSE00000212712 Chr8:96599023..96599160 CCAGCACTTTCCGTAGTTCC Chr8:96599006..96599025 59.73 55
downstream ENSMUSE00000212731 Chr8:96598192..96598304 ACCAGCAAACTTCGGATGAG Chr8:96598203..96598222 60.26 50
downstream ENSMUSE00000212719 Chr8:96593862..96594010 TCTTTGGATTGCTTGGTTCA Chr8:96593856..96593875 59.25 40
downstream ENSMUSE00000298659 Chr8:96591854..96592282 CCGGAGTGCTTTGTCCTTAG Chr8:96592017..96592036 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCAGAGCTGTAATCGCCTTG Chr8:96610581..96610602 60.03 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCATCCATGCTTTTGACAT Chr8:96610603..96610624 60.1 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031755