Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31444
Trapped Gene
A430093F15Rik (ENSMUSG00000067577)
Vector Insertion
Chr 19: 10815493 - 10856251
Public Clones IST13149E1 (tigm) IST10668H3 (tigm) IST11343C2 (tigm) IST13149F3 (tigm)
IST12400A3 (tigm) IST12551D4 (tigm) IST12628B6 (tigm) IST11484G11 (tigm)
IST14998H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621261 (Chr19:10815437..10815492 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACAGGCTCTGCCCTATTG Chr19:10815458..10815477 62.07 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621261 (Chr19:10815437..10815492 +)
Downstram Exon
ENSMUSE00000549124 (Chr19:10856252..10857571 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACAGGCTCTGCCCTATTG Chr19:10815458..10815477 62.07 60 CTCTCTAGAGGAGCGGCTGA Chr19:10857484..10857503 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621261 Chr19:10815437..10815492 GGACAGGCTCTGCCCTATTG Chr19:10815458..10815477 62.07 60

*** Putative Vector Insertion (Chr 19: 10815493 - 10856251) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000549124 Chr19:10856252..10857571 CTCTCTAGAGGAGCGGCTGA Chr19:10857484..10857503 59.99 60
downstream ENSMUSE00000452651 Chr19:10859723..10859835 AGAGTCTGCCCTGACTCGTG Chr19:10859816..10859835 60.61 60
downstream ENSMUSE00000549123 Chr19:10859908..10860533 GGATGCAATCAGGGTCAAGT Chr19:10860316..10860335 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGTGGCTAATCGCCTTG Chr19:10842535..10842555 61.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr19:10842540..10842560 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067577