Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31445
Trapped Gene
AC115877.13 (ENSMUSG00000079105)
Vector Insertion
Chr 15: 4981890 - 4984354
Public Clones IST10668H3 (tigm) IST13054C6 (tigm) IST14512C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684948 (Chr15:4984186..4984353 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTACGGTCATGGTTCAGCA Chr15:4984210..4984229 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684948 (Chr15:4984186..4984353 -)
Downstram Exon
ENSMUSE00000684947 (Chr15:4981891..4982133 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTACGGTCATGGTTCAGCA Chr15:4984210..4984229 59.72 50 ACCGTCGGTAGGCACTGTAG Chr15:4981964..4981983 60.19 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684955 Chr15:5013657..5013748 AGACTGTGGGGGAGACAAGA Chr15:5013724..5013743 59.68 55
upstream ENSMUSE00000684954 Chr15:5009396..5009451 AGCAGCGTTTCAAGTCTTCTC Chr15:5009399..5009419 58.88 47.62
upstream ENSMUSE00000684953 Chr15:5007020..5007095 GAATGCAATGGCTGTACCAA Chr15:5007027..5007046 59.55 45
upstream ENSMUSE00000684952 Chr15:4999545..4999686 GGGACCGGTTTAGGTGTTTT Chr15:4999549..4999568 60.09 50
upstream ENSMUSE00000684950 Chr15:4996864..4997008 TCATTGGTTTGCAATGGAGA Chr15:4996972..4996991 60.05 40
upstream ENSMUSE00000684949 Chr15:4995645..4995783 CCAAAAGTTTCGGTGGTCAG Chr15:4995720..4995739 60.52 50
upstream ENSMUSE00000684948 Chr15:4984186..4984353 CTTACGGTCATGGTTCAGCA Chr15:4984210..4984229 59.72 50
upstream ENSMUSE00000684947 Chr15:4981891..4982133 CCTGCAGTCTGGGTCCTTAG Chr15:4981941..4981960 59.86 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGTTGGTTAATCGCCTTG Chr15:4984292..4984312 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGCAGTTGGTCGTGACTG Chr15:4984295..4984315 59.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079105