Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31453
Trapped Gene
Fbxw7 (ENSMUSG00000028086)
Vector Insertion
Chr 3: 84694175 - 84707422
Public Clones IST12561B9 (tigm) IST13320C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674101 (Chr3:84694017..84694174 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACATGGAAACCAGAGACC Chr3:84694119..84694138 60.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674101 (Chr3:84694017..84694174 +)
Downstram Exon
ENSMUSE00000674111 (Chr3:84707423..84708001 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACATGGAAACCAGAGACC Chr3:84694119..84694138 60.52 55 TGGGTATCGTTCTGGTCTCC Chr3:84707712..84707731 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674115 Chr3:84619190..84619691 TTCGAGCTTTCTGATCGTGA Chr3:84619404..84619423 59.67 45
upstream ENSMUSE00000674100 Chr3:84619499..84619691 TAGCACCGCTTCTTCCTCAG Chr3:84619577..84619596 60.67 55
upstream ENSMUSE00000674114 Chr3:84667886..84667933 No primer for this exon
upstream ENSMUSE00000674113 Chr3:84668059..84668122 No primer for this exon
upstream ENSMUSE00000674102 Chr3:84668067..84668122 No primer for this exon
upstream ENSMUSE00000674101 Chr3:84694017..84694174 GCACATGGAAACCAGAGACC Chr3:84694119..84694138 60.52 55

*** Putative Vector Insertion (Chr 3: 84694175 - 84707422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674111 Chr3:84707423..84708001 TGGGTATCGTTCTGGTCTCC Chr3:84707712..84707731 59.93 55
downstream ENSMUSE00000720664 Chr3:84707423..84708001 TGGGTATCGTTCTGGTCTCC Chr3:84707712..84707731 59.93 55
downstream ENSMUSE00000674095 Chr3:84729402..84729721 CCTTCTCTTTGCGAGTGTCC Chr3:84729437..84729456 59.99 55
downstream ENSMUSE00000299439 Chr3:84756295..84756561 CTCAGAACCAGAACGCTGCT Chr3:84756335..84756354 60.73 55
downstream ENSMUSE00000175994 Chr3:84758797..84758879 TCCCAAAGAAAAGGAACGAA Chr3:84758850..84758869 59.66 40
downstream ENSMUSE00000175997 Chr3:84762426..84762567 GTTGGTGTTGCTGAACATGG Chr3:84762464..84762483 60.01 50
downstream ENSMUSE00000175996 Chr3:84769170..84769304 TGGAACTGGGGCTCTATCAC Chr3:84769276..84769295 60.07 55
downstream ENSMUSE00000176000 Chr3:84771362..84771485 CCTCAGCCAAAATTCTCCAG Chr3:84771452..84771471 59.81 50
downstream ENSMUSE00000674099 Chr3:84771362..84771535 CCTCAGCCAAAATTCTCCAG Chr3:84771452..84771471 59.81 50
downstream ENSMUSE00000176001 Chr3:84773087..84773223 CTTGATGTGCAACGGTTCAT Chr3:84773115..84773134 59.57 45
downstream ENSMUSE00000175992 Chr3:84774718..84774831 TAACTATGCGGTTGCCACAA Chr3:84774784..84774803 60.13 45
downstream ENSMUSE00000175991 Chr3:84776297..84776478 TGAGAGTCCGGTCAGTCGAT Chr3:84776393..84776412 60.83 55
downstream ENSMUSE00000175995 Chr3:84778325..84778550 GCATCTCGAGAACCGCTTAC Chr3:84778351..84778370 59.99 55
downstream ENSMUSE00000175999 Chr3:84780096..84780306 GGTGTCCTGTTAGCGTGTGA Chr3:84780195..84780214 59.75 55
downstream ENSMUSE00000590321 Chr3:84781195..84783119 GATGCTACGACTGACCAGCA Chr3:84782710..84782729 60.02 55
downstream ENSMUSE00000674103 Chr3:84781195..84783120 GATGCTACGACTGACCAGCA Chr3:84782710..84782729 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGACCAATAATCGCCTTGC Chr3:84700218..84700238 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGCTGTGACCAACGTGAC Chr3:84694212..84694232 60.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028086