Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31458
Trapped Gene
4930579E17Rik (ENSMUSG00000043153)
Vector Insertion
Chr 12: 37274548 - 37414835
Public Clones IST13959H5 (tigm) IST14997A10 (tigm) IST14997A10 (tigm) IST13959H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000490508 (Chr12:37274416..37274547 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTGTGGATTAGGGGGTTA Chr12:37274468..37274487 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000490508 (Chr12:37274416..37274547 +)
Downstram Exon
ENSMUSE00000350212 (Chr12:37414836..37416031 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTGTGGATTAGGGGGTTA Chr12:37274468..37274487 60.04 50 AGGTGGTGCCTTAGGGAAGT Chr12:37415001..37415020 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403551 Chr12:37108106..37108611 GCCGCTCATCAGCTACACTT Chr12:37108576..37108595 60.57 55
upstream ENSMUSE00000532645 Chr12:37116933..37117209 CGCCACAGATCAATTTTCAA Chr12:37117051..37117070 59.66 40
upstream ENSMUSE00000338184 Chr12:37152876..37153025 AGCAATTCGACCTCTGGTGT Chr12:37152884..37152903 59.73 50
upstream ENSMUSE00000406492 Chr12:37199689..37199793 GAGTGCTTGCAGTTGGCTCT Chr12:37199719..37199738 60.74 55
upstream ENSMUSE00000372227 Chr12:37203287..37203332 GCAGCTGAAGCCATGATTAAA Chr12:37203311..37203331 60.36 42.86
upstream ENSMUSE00000377604 Chr12:37228565..37228659 TGAGGAAGCGCTAAGAAAGG Chr12:37228632..37228651 59.72 50
upstream ENSMUSE00000332391 Chr12:37248020..37248109 ATGGATCACATAGGCGGAGA Chr12:37248044..37248063 60.45 50
upstream ENSMUSE00000363308 Chr12:37248546..37248638 No primer for this exon
upstream ENSMUSE00000490508 Chr12:37274416..37274547 TGGTGTGGATTAGGGGGTTA Chr12:37274468..37274487 60.04 50

*** Putative Vector Insertion (Chr 12: 37274548 - 37414835) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000350212 Chr12:37414836..37416031 AGGTGGTGCCTTAGGGAAGT Chr12:37415001..37415020 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr12:37310598..37310618 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGTCCTTGCTCGTGACT Chr12:37310586..37310606 59.91 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043153