Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3146
Trapped Gene
Cdc37l1 (ENSMUSG00000024780)
Vector Insertion
Chr 19: 29069813 - 29073750
Public Clones CD0064 (sanger) XK007 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000144925 (Chr19:29069531..29069812 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAACATGGATGCCATTAGC Chr19:29069775..29069794 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000144925 (Chr19:29069531..29069812 +)
Downstram Exon
ENSMUSE00000144926 (Chr19:29073751..29073841 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAACATGGATGCCATTAGC Chr19:29069775..29069794 60.3 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408401 Chr19:29064984..29065159 CGTCCCACTACTCTCCGGTA Chr19:29065122..29065141 60.13 60
upstream ENSMUSE00000144925 Chr19:29069531..29069812 GGAACATGGATGCCATTAGC Chr19:29069775..29069794 60.3 50

*** Putative Vector Insertion (Chr 19: 29069813 - 29073750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144926 Chr19:29073751..29073841 No primer for this exon
downstream ENSMUSE00000144922 Chr19:29081462..29081577 ACATACGAGGTGTGGGTGGT Chr19:29081526..29081545 60.16 55
downstream ENSMUSE00000144918 Chr19:29082063..29082185 TGTTCCATTAGAGCGCCTTT Chr19:29082085..29082104 59.85 45
downstream ENSMUSE00000489299 Chr19:29086379..29086543 CAGAATGGGGGACATGATTC Chr19:29086508..29086527 60.13 50
downstream ENSMUSE00000444339 Chr19:29090496..29092059 GTAGGTCACCACTGCGGATT Chr19:29091097..29091116 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCTCTGGAACATGGATGC Chr19:29072769..29072789 59.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCTCTGGAACATGGATGC Chr19:29072769..29072789 59.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024780