Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31461
Trapped Gene
Olig2 (ENSMUSG00000039830)
Vector Insertion
Chr 16: 91225899 - 91226589
Public Clones IST12494F12 (tigm) IST12494G12 (tigm) IST13230G11 (tigm) IST11560E2 (tigm)
IST11492D8 (tigm) IST12494F12 (tigm) IST10046B7 (tigm) IST14730H9 (tigm)
IST14538E7 (tigm) IST11492D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249809 (Chr16:91225817..91225898 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGAGCACCTCAAATCTA Chr16:91225872..91225891 59.17 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249809 (Chr16:91225817..91225898 +)
Downstram Exon
ENSMUSE00000357734 (Chr16:91226590..91228920 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGAGCACCTCAAATCTA Chr16:91225872..91225891 59.17 50 CCAGTCGGGTAAGAAACCAA Chr16:91228438..91228457 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000249809 Chr16:91225817..91225898 CAGCGAGCACCTCAAATCTA Chr16:91225872..91225891 59.17 50

*** Putative Vector Insertion (Chr 16: 91225899 - 91226589) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000357734 Chr16:91226590..91228920 CCAGTCGGGTAAGAAACCAA Chr16:91228438..91228457 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGAGCACCTCAAATCTAATTC Chr16:91225875..91225897 60.23 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039830