Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31466
Trapped Gene
C330021F23Rik (ENSMUSG00000065952)
Vector Insertion
Chr 8: 3582808 - 3583834
Public Clones IST12285B10 (tigm) IST12285B10 (tigm) IST10065F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686580 (Chr8:3582802..3582807 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686580 (Chr8:3582802..3582807 +)
Downstram Exon
ENSMUSE00000568598 (Chr8:3583835..3584776 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGCTCAGGATCAGATTCAGC Chr8:3584375..3584394 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686580 Chr8:3582802..3582807 No primer for this exon

*** Putative Vector Insertion (Chr 8: 3582808 - 3583834) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568598 Chr8:3583835..3584776 GGCTCAGGATCAGATTCAGC Chr8:3584375..3584394 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCCTCACACCTTGCCTTG Chr8:3582838..3582858 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTCCTCACACCTTGCCTTG Chr8:3582838..3582858 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000065952