Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31477
Trapped Gene
Fignl1 (ENSMUSG00000035455)
Vector Insertion
Chr 11: 11700290 - 11706219
Public Clones IST14313E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681146 (Chr11:11705962..11706218 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAACTCGGCCTTGATTTCTG Chr11:11706130..11706149 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681146 (Chr11:11705962..11706218 -)
Downstram Exon
ENSMUSE00000330037 (Chr11:11700291..11703066 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAACTCGGCCTTGATTTCTG Chr11:11706130..11706149 59.81 50 CCCATCAGACTGCTGCACTA Chr11:11701202..11701221 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444730 Chr11:11708898..11708935 No primer for this exon
upstream ENSMUSE00000330044 Chr11:11706099..11706218 GAACTCGGCCTTGATTTCTG Chr11:11706130..11706149 59.81 50
upstream ENSMUSE00000681146 Chr11:11705962..11706218 GAACTCGGCCTTGATTTCTG Chr11:11706130..11706149 59.81 50
upstream ENSMUSE00000681145 Chr11:11700555..11703066 AAGACCGGATTCTTGTGGTG Chr11:11701404..11701423 59.97 50
upstream ENSMUSE00000330037 Chr11:11700291..11703066 AAGACCGGATTCTTGTGGTG Chr11:11701404..11701423 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr11:11703151..11703171 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCTGTTCCATGCAGCTC Chr11:11703214..11703234 58.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035455