Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31484
Trapped Gene
Rhobtb2 (ENSMUSG00000022075)
Vector Insertion
Chr 14: 70200424 - 70205278
Public Clones IST13036B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398730 (Chr14:70204844..70205277 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGTGCTTAGCAGGAAGAG Chr14:70204887..70204906 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398730 (Chr14:70204844..70205277 -)
Downstram Exon
ENSMUSE00000556584 (Chr14:70200425..70200626 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGTGCTTAGCAGGAAGAG Chr14:70204887..70204906 59.92 55 CGCACTTGATGGTCTCTACG Chr14:70200543..70200562 59.47 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398730 Chr14:70204844..70205277 AGCGTGCTTAGCAGGAAGAG Chr14:70204887..70204906 59.92 55
upstream ENSMUSE00000556584 Chr14:70200425..70200626 AAGGCCAAACGTAGAGACCA Chr14:70200574..70200593 59.73 50

*** Putative Vector Insertion (Chr 14: 70200424 - 70205278) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556573 Chr14:70199485..70199588 GACGCTGACGTCATCTACCA Chr14:70199525..70199544 59.86 55
downstream ENSMUSE00000123406 Chr14:70197946..70198131 CTGTTAACGGCTTCCAGGTC Chr14:70197945..70197964 59.73 55
downstream ENSMUSE00000263693 Chr14:70196081..70197099 CGTAAGATCCCGTCACTGGT Chr14:70196445..70196464 59.99 55
downstream ENSMUSE00000556556 Chr14:70195707..70195825 GAAATCAGCAGGGGCTTATG Chr14:70195746..70195765 59.67 50
downstream ENSMUSE00000496573 Chr14:70193711..70193861 CTCCAACACAGCTCTCATGC Chr14:70193792..70193811 59.58 55
downstream ENSMUSE00000123410 Chr14:70188439..70188527 ATACAAGGACATCCCCATCG Chr14:70188434..70188453 59.63 50
downstream ENSMUSE00000123407 Chr14:70187665..70187770 CGGCACACGTTGTTGTAGTT Chr14:70187678..70187697 59.68 50
downstream ENSMUSE00000123402 Chr14:70184799..70187542 CTCACGGCCTAGGAGACTTG Chr14:70186778..70186797 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr14:70205208..70205228 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGAGGTCGTGAGCGGTCT Chr14:70205307..70205327 63.6 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022075