Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31488
Trapped Gene
Sesn1 (ENSMUSG00000038332)
Vector Insertion
Chr 10: 41531107 - 41607254
Public Clones IST10390F7 (tigm) IST14740D3 (tigm) IST13520B4 (tigm) IST12742A5 (tigm)
IST10984G3 (tigm) IST13520B4 (tigm) IST12280H8 (tigm) IST10992D7 (tigm)
IST13011E3 (tigm) IST13074D11 (tigm) IST11407C7 (tigm) IST12818H1 (tigm)
IST10237E12 (tigm) IST11298H4 (tigm) IST10921H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643992 (Chr10:41530828..41531106 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGACCTTCAGACGGACTTTC Chr10:41530969..41530988 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643992 (Chr10:41530828..41531106 +)
Downstram Exon
ENSMUSE00000296677 (Chr10:41607255..41607401 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGACCTTCAGACGGACTTTC Chr10:41530969..41530988 59.84 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643992 Chr10:41530828..41531106 CGACCTTCAGACGGACTTTC Chr10:41530969..41530988 59.84 55

*** Putative Vector Insertion (Chr 10: 41531107 - 41607254) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296677 Chr10:41607255..41607401 No primer for this exon
downstream ENSMUSE00000296669 Chr10:41613848..41613913 CGAGGGATTCTGATTCCAAG Chr10:41613873..41613892 59.62 50
downstream ENSMUSE00000296663 Chr10:41614626..41614826 GCCGATAATGGAGGGGTAAT Chr10:41614812..41614831 60.01 50
downstream ENSMUSE00000296654 Chr10:41615829..41616011 CAAGGCCTATGGGCTAACAC Chr10:41615989..41616008 59.59 55
downstream ENSMUSE00000296649 Chr10:41617989..41618231 CATCGCAATGAATCTCTGGA Chr10:41618124..41618143 59.76 45
downstream ENSMUSE00000296643 Chr10:41622335..41622482 CCTCTCGGCATTCCTGTAAC Chr10:41622407..41622426 59.69 55
downstream ENSMUSE00000296633 Chr10:41623498..41623610 TCAAAGTGCCGAGACACATC Chr10:41623546..41623565 59.84 50
downstream ENSMUSE00000296627 Chr10:41624980..41625170 GTTCCAGATAGCCCGTCTGA Chr10:41625147..41625166 60.22 55
downstream ENSMUSE00000296620 Chr10:41626142..41626286 CTTTTCAGGAGTGCACACGA Chr10:41626235..41626254 60.03 50
downstream ENSMUSE00000666436 Chr10:41627078..41628227 TATTGGGAAACGCACATCAA Chr10:41627882..41627901 59.93 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGCGTCGAGGTAAGAGCA Chr10:41531097..41531117 60.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCGTCGAGGTAAGAGCA Chr10:41576097..41576117 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038332