Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31493
Trapped Gene
Mrm1 (ENSMUSG00000018405)
Vector Insertion
Chr 11: 84632101 - 84633018
Public Clones IST13788A10 (tigm) IST13788A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398268 (Chr11:84632339..84633017 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398268 (Chr11:84632339..84633017 -)
Downstram Exon
ENSMUSE00000393724 (Chr11:84632102..84632195 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398268 Chr11:84632339..84633017 No primer for this exon
upstream ENSMUSE00000393724 Chr11:84632102..84632195 No primer for this exon

*** Putative Vector Insertion (Chr 11: 84632101 - 84633018) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105876 Chr11:84628410..84628542 No primer for this exon
downstream ENSMUSE00000274587 Chr11:84628191..84628310 No primer for this exon
downstream ENSMUSE00000335051 Chr11:84626565..84628013 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGGGAGGTGACTGTCTT Chr11:84632980..84633000 61.65 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018405