Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31494
Trapped Gene
Ahcyl2 (ENSMUSG00000029772)
Vector Insertion
Chr 6: 29749553 - 29803824
Public Clones IST11426F7 (tigm) IST13527G5 (tigm) IST13470H5 (tigm) IST14409B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656008 (Chr6:29749439..29749552 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGTAGCTGTACCCGAGGA Chr6:29749457..29749476 60.27 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656008 (Chr6:29749439..29749552 +)
Downstram Exon
ENSMUSE00000702136 (Chr6:29803825..29804139 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGTAGCTGTACCCGAGGA Chr6:29749457..29749476 60.27 60 CCTGGCGAATCTCTTACCAG Chr6:29803904..29803923 59.83 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656007 Chr6:29718480..29718906 GCTGGTGCGAGAGTCAGAGT Chr6:29718495..29718514 60.77 60
upstream ENSMUSE00000660968 Chr6:29718492..29718906 GCTGGTGCGAGAGTCAGAGT Chr6:29718495..29718514 60.77 60
upstream ENSMUSE00000370905 Chr6:29718533..29718906 AGGTGGAGCTGAAGGATCTG Chr6:29718584..29718603 59.4 55
upstream ENSMUSE00000656008 Chr6:29749439..29749552 CCAGTAGCTGTACCCGAGGA Chr6:29749457..29749476 60.27 60

*** Putative Vector Insertion (Chr 6: 29749553 - 29803824) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702136 Chr6:29803825..29804139 CCTGGCGAATCTCTTACCAG Chr6:29803904..29803923 59.83 55
downstream ENSMUSE00000702132 Chr6:29809723..29809779 No primer for this exon
downstream ENSMUSE00000564207 Chr6:29813140..29813251 GATTTTGGTGGGACGTTTGT Chr6:29813196..29813215 59.69 45
downstream ENSMUSE00000702143 Chr6:29813143..29813251 GATTTTGGTGGGACGTTTGT Chr6:29813196..29813215 59.69 45
downstream ENSMUSE00000564205 Chr6:29820568..29820711 CCAAACTCCGCTTGTTTGAT Chr6:29820685..29820704 60.11 45
downstream ENSMUSE00000192531 Chr6:29821186..29821286 GCTTTTCTCCTTGGGCTCTC Chr6:29821236..29821255 60.46 55
downstream ENSMUSE00000301439 Chr6:29828529..29828631 CCACTTCATTGAGGGTGGAG Chr6:29828613..29828632 60.5 55
downstream ENSMUSE00000192539 Chr6:29830549..29830643 ATCTGTCAATGCACCACCAA Chr6:29830614..29830633 59.97 45
downstream ENSMUSE00000192542 Chr6:29833623..29833729 TCTCCTCGACTATGCCTTTGA Chr6:29833712..29833732 59.96 47.62
downstream ENSMUSE00000564201 Chr6:29836118..29836234 CTTCCCAGCTTTGGACAGTT Chr6:29836148..29836167 59.33 50
downstream ENSMUSE00000192522 Chr6:29840681..29840744 CCTGCTTTCCACCAAACATC Chr6:29840724..29840743 60.49 50
downstream ENSMUSE00000564197 Chr6:29841201..29841289 GCACAGATGGGGTCAATCTC Chr6:29841280..29841299 60.48 55
downstream ENSMUSE00000192518 Chr6:29844819..29844889 GTCGACCTGTCGGATGACTT Chr6:29844873..29844892 60.12 55
downstream ENSMUSE00000564195 Chr6:29846322..29846416 CACATCAATCTCGGTGTTGG Chr6:29846419..29846438 59.96 50
downstream ENSMUSE00000192521 Chr6:29853189..29853287 CCAGGTCAGTTCTGGTGTCC Chr6:29853221..29853240 60.56 60
downstream ENSMUSE00000564192 Chr6:29856508..29856576 GCAGTGATGGAGAGCACAAA Chr6:29856569..29856588 59.99 50
downstream ENSMUSE00000192541 Chr6:29856681..29856759 GCTTATAGCGACCCTCAGGA Chr6:29856732..29856751 59.43 55
downstream ENSMUSE00000660967 Chr6:29858347..29858467 ATCAAAGGTGGGCAGGTGTA Chr6:29858387..29858406 60.38 50
downstream ENSMUSE00000660966 Chr6:29859040..29862304 GCCCCACGAGTTAGTAACCA Chr6:29859254..29859273 59.99 55
downstream ENSMUSE00000702134 Chr6:29859040..29859213 GCAGCTTGCTAGGTTCTTCC Chr6:29859137..29859156 59.22 55
downstream ENSMUSE00000702147 Chr6:29859040..29862309 GCCCCACGAGTTAGTAACCA Chr6:29859254..29859273 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTTTAGATACAGGGTTTTGGAA Chr6:29800513..29800537 59.68 37.5 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTTAGATACAGGGTTTTGGAA Chr6:29800513..29800537 59.68 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029772