Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3150
Trapped Gene
Rps8 (ENSMUSG00000047675)
Vector Insertion
Chr 4: 116827713 - 116828175
Public Clones XT0328 (sanger) AW0198 (sanger) XR0650 (sanger) FHCRC-GT-S17-9C2 (fhcrc)
PST1293 (escells)
Private Clones OST305276 (lexicon) OST261696 (lexicon) OST37954 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662320 (Chr4:116828176..116828282 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTAAGCGAAAACCCTACC Chr4:116828223..116828242 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662320 (Chr4:116828176..116828282 -)
Downstram Exon
ENSMUSE00000465282 (Chr4:116827613..116827712 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTAAGCGAAAACCCTACC Chr4:116828223..116828242 59.83 55 CAATCTCAGGGCACGGTACT Chr4:116827622..116827641 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662321 Chr4:116828663..116828737 TTAGAAACCGGACCGTGAAG Chr4:116828701..116828720 60.1 50
upstream ENSMUSE00000705664 Chr4:116828663..116828689 No primer for this exon
upstream ENSMUSE00000662320 Chr4:116828176..116828282 GGGTAAGCGAAAACCCTACC Chr4:116828223..116828242 59.83 55

*** Putative Vector Insertion (Chr 4: 116827713 - 116828175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465282 Chr4:116827613..116827712 CAATCTCAGGGCACGGTACT Chr4:116827622..116827641 60.13 55
downstream ENSMUSE00000464404 Chr4:116827243..116827418 GTACGGCGTGCTGTCAATAA Chr4:116827281..116827300 59.76 50
downstream ENSMUSE00000463465 Chr4:116826904..116827033 GCTGCTGATTTTGGCATTCT Chr4:116826919..116826938 60.36 45
downstream ENSMUSE00000339525 Chr4:116826441..116826592 CTGGTCGTGAGGCAATACAG Chr4:116826550..116826569 59.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr4:116828105..116828125 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGAAGCGAAAGTATGAGCTG Chr4:116828198..116828220 59.31 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047675