Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31500
Trapped Gene
Adck1 (ENSMUSG00000021044)
Vector Insertion
Chr 12: 89685202 - 89693922
Public Clones IST14132A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653056 (Chr12:89685085..89685201 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653056 (Chr12:89685085..89685201 +)
Downstram Exon
ENSMUSE00000114125 (Chr12:89693923..89694072 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706188 Chr12:89598998..89599039 No primer for this exon
upstream ENSMUSE00000653067 Chr12:89606779..89606924 No primer for this exon
upstream ENSMUSE00000653065 Chr12:89610139..89610222 No primer for this exon
upstream ENSMUSE00000653061 Chr12:89640417..89640620 No primer for this exon
upstream ENSMUSE00000653058 Chr12:89669465..89669623 No primer for this exon
upstream ENSMUSE00000653057 Chr12:89679527..89679685 No primer for this exon
upstream ENSMUSE00000653056 Chr12:89685085..89685201 No primer for this exon

*** Putative Vector Insertion (Chr 12: 89685202 - 89693922) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000114125 Chr12:89693923..89694072 No primer for this exon
downstream ENSMUSE00000114124 Chr12:89695181..89695378 No primer for this exon
downstream ENSMUSE00000502213 Chr12:89697454..89697647 No primer for this exon
downstream ENSMUSE00000653053 Chr12:89699459..89700163 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGGTGTTAGGACAGAGG Chr12:89685213..89685233 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCAACGACAGGGCCTACAT Chr12:89685155..89685175 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021044