Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31514
Trapped Gene
Sertad2 (ENSMUSG00000049800)
Vector Insertion
Chr 11: 20443764 - 20531979
Public Clones (ggtc) (ggtc) (ggtc) IST14280A8 (tigm) IST14393H5 (tigm) IST14596H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000593852 (Chr11:20443256..20443763 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTATCGCCCCTTTAGCCTGT Chr11:20443494..20443513 60.47 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000593852 (Chr11:20443256..20443763 +)
Downstram Exon
ENSMUSE00000680843 (Chr11:20531980..20532276 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTATCGCCCCTTTAGCCTGT Chr11:20443494..20443513 60.47 55 TTGCGAGTCGGGAACATTAT Chr11:20532130..20532149 60.47 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000593852 Chr11:20443256..20443763 GTATCGCCCCTTTAGCCTGT Chr11:20443494..20443513 60.47 55

*** Putative Vector Insertion (Chr 11: 20443764 - 20531979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680843 Chr11:20531980..20532276 TTGCGAGTCGGGAACATTAT Chr11:20532130..20532149 60.47 45
downstream ENSMUSE00000680841 Chr11:20547158..20547355 CTTCTTGCCTGTCGGGTATC Chr11:20547298..20547317 59.69 55
downstream ENSMUSE00000580920 Chr11:20547805..20553026 AAGCAACCAGATTGGACACC Chr11:20550326..20550345 59.97 50
downstream ENSMUSE00000680840 Chr11:20547805..20549068 GGGGTCAAAATCGTACATGG Chr11:20548576..20548595 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTGTTTCCTTTGTGACCA Chr11:20491750..20491771 59.99 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTTTGTTTCCTTTGTGACCA Chr11:20491750..20491771 59.99 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049800