Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31517
Trapped Gene
4930433N12Rik (ENSMUSG00000042360)
Vector Insertion
Chr 9: 3192819 - 3199783
Public Clones IST11681G11 (tigm) IST12631E6 (tigm) IST14371H7 (tigm) IST11449C12 (tigm)
IST10672A10 (tigm) IST14606C10 (tigm) IST14307D3 (tigm) IST14150H10 (tigm)
IST11731B9 (tigm) IST12458E10 (tigm) IST14449H11 (tigm) IST10231G3 (tigm)
IST14418C4 (tigm) IST13957H8 (tigm) IST13413A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704006 (Chr9:3199537..3199782 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTAGGAGCGCAAAAAGTGG Chr9:3199689..3199708 60.37 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704006 (Chr9:3199537..3199782 -)
Downstram Exon
ENSMUSE00000704005 (Chr9:3192820..3193048 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTAGGAGCGCAAAAAGTGG Chr9:3199689..3199708 60.37 45 ATGGATCGGTTCCTTCACAG Chr9:3192921..3192940 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704006 Chr9:3199537..3199782 TTTAGGAGCGCAAAAAGTGG Chr9:3199689..3199708 60.37 45
upstream ENSMUSE00000704005 Chr9:3192820..3193048 AGGCCAGCTACATCAAATGG Chr9:3192990..3193009 60.1 50

*** Putative Vector Insertion (Chr 9: 3192819 - 3199783) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000704004 Chr9:3192312..3192412 TGAGTTTTCAATCGGCAACA Chr9:3192316..3192335 60.23 40
downstream ENSMUSE00000262182 Chr9:3190583..3190805 GGCTGACAAACCTGAAGCTC Chr9:3190701..3190720 60 55
downstream ENSMUSE00000262160 Chr9:3134876..3135102 CATCAAAGGGTTCTGGGTGT Chr9:3134939..3134958 59.82 50
downstream ENSMUSE00000340445 Chr9:3133847..3134024 TGGATATCCTCGATGGTTGA Chr9:3133965..3133984 58.87 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTGTTTAATCGCCTTGCAG Chr9:3193718..3193739 59.42 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTATCGTGACTGGGAAAACC Chr9:3193716..3193737 58.42 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042360