Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31520
Trapped Gene
Adamts6 (ENSMUSG00000046169)
Vector Insertion
Chr 13: 105078194 - 105084526
Public Clones IST11502C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457266 (Chr13:105077915..105078193 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGTGCGAAGTGGACTTGA Chr13:105078126..105078145 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457266 (Chr13:105077915..105078193 +)
Downstram Exon
ENSMUSE00000715144 (Chr13:105084527..105084904 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGTGCGAAGTGGACTTGA Chr13:105078126..105078145 59.88 50 CAAGTCAACGTTTTCCACGA Chr13:105084839..105084858 59.73 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000457266 Chr13:105077915..105078193 GTTGTGCGAAGTGGACTTGA Chr13:105078126..105078145 59.88 50
upstream ENSMUSE00000679838 Chr13:105077953..105078080 TAAAATTCCGGGGCTTACAG Chr13:105078061..105078080 59.08 45

*** Putative Vector Insertion (Chr 13: 105078194 - 105084526) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000714886 Chr13:105084527..105084904 CAAGTCAACGTTTTCCACGA Chr13:105084839..105084858 59.73 45
downstream ENSMUSE00000715144 Chr13:105084527..105084904 CAAGTCAACGTTTTCCACGA Chr13:105084839..105084858 59.73 45
downstream ENSMUSE00000639884 Chr13:105087242..105087606 GCTTGCCATAGGCTGAAAGT Chr13:105087430..105087449 59.48 50
downstream ENSMUSE00000639892 Chr13:105087242..105087606 GCTTGCCATAGGCTGAAAGT Chr13:105087430..105087449 59.48 50
downstream ENSMUSE00000639883 Chr13:105097301..105097469 GAAACCCCACAATGAGAATGA Chr13:105097469..105097489 59.78 42.86
downstream ENSMUSE00000639891 Chr13:105097301..105097469 GAAACCCCACAATGAGAATGA Chr13:105097469..105097489 59.78 42.86
downstream ENSMUSE00000639882 Chr13:105102795..105103006 TGGTAGCCCACCATCATTTT Chr13:105102963..105102982 60.19 45
downstream ENSMUSE00000639890 Chr13:105102795..105103006 TGGTAGCCCACCATCATTTT Chr13:105102963..105102982 60.19 45
downstream ENSMUSE00000639881 Chr13:105103716..105103799 No primer for this exon
downstream ENSMUSE00000639889 Chr13:105103716..105103799 No primer for this exon
downstream ENSMUSE00000639880 Chr13:105104318..105104463 ATCGAGGGACTTGTCTGCAT Chr13:105104362..105104381 59.69 50
downstream ENSMUSE00000639886 Chr13:105104318..105104463 ATCGAGGGACTTGTCTGCAT Chr13:105104362..105104381 59.69 50
downstream ENSMUSE00000312731 Chr13:105137428..105137471 GTGTTCCACAGGGCTTGTTT Chr13:105137471..105137490 60.01 50
downstream ENSMUSE00000610565 Chr13:105137428..105137471 GTGTTCCACAGGGCTTGTTT Chr13:105137471..105137490 60.01 50
downstream ENSMUSE00000639879 Chr13:105142838..105142943 AGCCTAGGCCAATGTCTTCA Chr13:105142912..105142931 59.84 50
downstream ENSMUSE00000639885 Chr13:105142838..105142943 AGCCTAGGCCAATGTCTTCA Chr13:105142912..105142931 59.84 50
downstream ENSMUSE00000456912 Chr13:105156874..105157020 ATGACCTTTCGTCCCACAAG Chr13:105156928..105156947 59.97 50
downstream ENSMUSE00000610562 Chr13:105156874..105157020 ATGACCTTTCGTCCCACAAG Chr13:105156928..105156947 59.97 50
downstream ENSMUSE00000610571 Chr13:105159734..105159870 TTAATCAGGACGGCTTCTGG Chr13:105159798..105159817 60.21 50
downstream ENSMUSE00000519192 Chr13:105165722..105165863 TTGCTCCATACTGGAAACGA Chr13:105165843..105165862 59.27 45
downstream ENSMUSE00000639878 Chr13:105165722..105165863 TTGCTCCATACTGGAAACGA Chr13:105165843..105165862 59.27 45
downstream ENSMUSE00000610561 Chr13:105180158..105180265 GTGACACAGCGGTTGCTTTT Chr13:105180210..105180229 61.28 50
downstream ENSMUSE00000610570 Chr13:105180158..105180265 GTGACACAGCGGTTGCTTTT Chr13:105180210..105180229 61.28 50
downstream ENSMUSE00000312692 Chr13:105187942..105188087 CAGCCCCCATCAATACTCTG Chr13:105188006..105188025 60.47 55
downstream ENSMUSE00000492261 Chr13:105187942..105188087 CAGCCCCCATCAATACTCTG Chr13:105188006..105188025 60.47 55
downstream ENSMUSE00000610560 Chr13:105190023..105190086 CTGTGTTGCAAGAGCGGTAG Chr13:105190087..105190106 59.66 55
downstream ENSMUSE00000610569 Chr13:105190023..105190086 CTGTGTTGCAAGAGCGGTAG Chr13:105190087..105190106 59.66 55
downstream ENSMUSE00000457009 Chr13:105203788..105203890 AAAATCTCGGGAACCCAAAG Chr13:105203817..105203836 60.29 45
downstream ENSMUSE00000610559 Chr13:105217015..105217148 AGCCAGGCAATTTAATGCAC Chr13:105217052..105217071 60.1 45
downstream ENSMUSE00000610568 Chr13:105217015..105217148 AGCCAGGCAATTTAATGCAC Chr13:105217052..105217071 60.1 45
downstream ENSMUSE00000456890 Chr13:105218915..105219038 ACCACAGACTCGGCACCTAT Chr13:105218980..105218999 59.6 55
downstream ENSMUSE00000569018 Chr13:105218915..105219038 ACCACAGACTCGGCACCTAT Chr13:105218980..105218999 59.6 55
downstream ENSMUSE00000491387 Chr13:105219870..105219950 CTTGGTATCTGAACCACTTCCA Chr13:105219898..105219919 59.1 45.46
downstream ENSMUSE00000610567 Chr13:105219870..105219950 CTTGGTATCTGAACCACTTCCA Chr13:105219898..105219919 59.1 45.46
downstream ENSMUSE00000456993 Chr13:105234133..105234296 CTGTCCCCGAAACATCAAAT Chr13:105234219..105234238 59.79 45
downstream ENSMUSE00000569016 Chr13:105234133..105234296 CTGTCCCCGAAACATCAAAT Chr13:105234219..105234238 59.79 45
downstream ENSMUSE00000490137 Chr13:105234895..105235033 CACTGCCAGTACGAACGATG Chr13:105234967..105234986 60.32 55
downstream ENSMUSE00000507773 Chr13:105234895..105235784 TGCCCCTTAACTTTGATTGC Chr13:105235504..105235523 60.07 45
downstream ENSMUSE00000489217 Chr13:105252308..105252437 CAGTGTTGCAGGCTCTTTGA Chr13:105252424..105252443 60.17 50
downstream ENSMUSE00000462975 Chr13:105260425..105260629 GTCGCCGTAGTCCAGTGTTT Chr13:105260548..105260567 60.18 55
downstream ENSMUSE00000461939 Chr13:105266733..105266909 ACAATCCGATGCTTGAATCC Chr13:105266776..105266795 59.9 45
downstream ENSMUSE00000460463 Chr13:105269599..105269755 AGGGGTGCTATCACATTTGC Chr13:105269742..105269761 59.96 50
downstream ENSMUSE00000467053 Chr13:105283675..105286766 GGGCACATACGTGAAGGACT Chr13:105285336..105285355 60 55
downstream ENSMUSE00000639877 Chr13:105283675..105284843 CAAACGCTCCACAGTAAGCA Chr13:105284059..105284078 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGATAATCGCCTTGCAGCAC Chr13:105078241..105078262 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTTCGTGACTGGGAAAA Chr13:105078239..105078259 58.41 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046169