Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31534
Trapped Gene
Dlg2 (ENSMUSG00000052572)
Vector Insertion
Chr 7: 99237229 - 99275049
Public Clones IST11196A12 (tigm) IST10544F9 (tigm) IST12433F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000491551 (Chr7:99237072..99237228 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGACCAGCAGACCTGAGT Chr7:99237176..99237195 60.31 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000491551 (Chr7:99237072..99237228 +)
Downstram Exon
ENSMUSE00000493673 (Chr7:99275050..99275152 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGACCAGCAGACCTGAGT Chr7:99237176..99237195 60.31 60 CTCCTCGAAGATCGATTCCA Chr7:99275077..99275096 60.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672371 Chr7:98239238..98239558 GCTGAATCCTCGGCTAATTG Chr7:98239267..98239286 59.81 50
upstream ENSMUSE00000672399 Chr7:98239517..98239558 GTGCACTCCGGACTAACGTA Chr7:98239536..98239555 58.8 55
upstream ENSMUSE00000500996 Chr7:98598264..98598425 ACTTGTGCATGTGTCGGAAA Chr7:98598341..98598360 60.16 45
upstream ENSMUSE00000672367 Chr7:98859930..98860308 GCTTCCCGAGCTGAGAATTA Chr7:98860219..98860238 59.55 50
upstream ENSMUSE00000519782 Chr7:98881601..98881654 GCCCTGCTCCTATAATTGTCA Chr7:98881605..98881625 59.2 47.62
upstream ENSMUSE00000520655 Chr7:98958989..98959039 No primer for this exon
upstream ENSMUSE00000514294 Chr7:99020886..99021010 ATCCCCACATTGGAGATGAC Chr7:99020929..99020948 59.59 50
upstream ENSMUSE00000517822 Chr7:99049245..99049414 TGTATCTTGCGGGTGAATGA Chr7:99049255..99049274 60.07 45
upstream ENSMUSE00000496200 Chr7:99088509..99088645 TGGAGCTGCACAGAAAGATG Chr7:99088594..99088613 60.14 50
upstream ENSMUSE00000498266 Chr7:99114106..99114250 TTATGGGCCACCGGATATTA Chr7:99114225..99114244 60 45
upstream ENSMUSE00000484426 Chr7:99116628..99116766 CCACCGATGGAAAATCATCT Chr7:99116636..99116655 59.75 45
upstream ENSMUSE00000485354 Chr7:99145676..99145831 TGCTTCTCCCAGGCACTATT Chr7:99145724..99145743 59.84 50
upstream ENSMUSE00000441920 Chr7:99189308..99189376 TCCCAGCACAGTACTGCAAC Chr7:99189312..99189331 59.9 55
upstream ENSMUSE00000672366 Chr7:99210904..99210969 No primer for this exon
upstream ENSMUSE00000672365 Chr7:99214767..99214916 TCTTCGCAGAGATGGGAGTT Chr7:99214879..99214898 59.95 50
upstream ENSMUSE00000491551 Chr7:99237072..99237228 GTGGACCAGCAGACCTGAGT Chr7:99237176..99237195 60.31 60

*** Putative Vector Insertion (Chr 7: 99237229 - 99275049) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493673 Chr7:99275050..99275152 CTCCTCGAAGATCGATTCCA Chr7:99275077..99275096 60.29 50
downstream ENSMUSE00000456002 Chr7:99435001..99435115 GGAGCGTTTCTGATTGGTTC Chr7:99435107..99435126 59.68 50
downstream ENSMUSE00000455991 Chr7:99524064..99524240 AGTGTGACCCTTCTGGCTTG Chr7:99524198..99524217 60.3 55
downstream ENSMUSE00000455984 Chr7:99535425..99535500 TCACACCAGGTTTTGCATTG Chr7:99535489..99535508 60.55 45
downstream ENSMUSE00000633671 Chr7:99565734..99565833 GGATCACTGGTTTCCTGCTC Chr7:99565831..99565850 59.66 55
downstream ENSMUSE00000455976 Chr7:99566598..99566643 TTGTTCCATAACCGTCGTCA Chr7:99566637..99566656 59.96 45
downstream ENSMUSE00000633670 Chr7:99569142..99569183 CGCTGGCATTAGAAGAGACG Chr7:99569168..99569187 61.06 55
downstream ENSMUSE00000455973 Chr7:99576201..99576251 TGCCTCGTGACAGGTTCATA Chr7:99576249..99576268 60.26 50
downstream ENSMUSE00000455966 Chr7:99577067..99577168 No primer for this exon
downstream ENSMUSE00000455962 Chr7:99579507..99579679 TCGACTTCGTAGTCACGCTTT Chr7:99579542..99579562 60.07 47.62
downstream ENSMUSE00000455957 Chr7:99586475..99586584 ATGGCAATGGGATAGAGCTG Chr7:99586554..99586573 60.06 50
downstream ENSMUSE00000455952 Chr7:99591114..99591205 TTTAATCGCCCGGTCATAAG Chr7:99591177..99591196 59.92 45
downstream ENSMUSE00000464440 Chr7:99593021..99595513 TTTCCCTTTCGATCATTTGC Chr7:99594193..99594212 60.02 40
downstream ENSMUSE00000672373 Chr7:99593021..99597599 TTTCCCTTTCGATCATTTGC Chr7:99594193..99594212 60.02 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr7:99237279..99237299 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTTCCGTGACTGGGAAAA Chr7:99249274..99249294 61.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052572