Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31565
Trapped Gene
Ptges (ENSMUSG00000050737)
Vector Insertion
Chr 2: 30757233 - 30758820
Public Clones IST15069H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662813 (Chr2:30758610..30758819 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCACTCTCAGTCCCGGTGT Chr2:30758771..30758790 60.31 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662813 (Chr2:30758610..30758819 -)
Downstram Exon
ENSMUSE00000696302 (Chr2:30757234..30757308 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCACTCTCAGTCCCGGTGT Chr2:30758771..30758790 60.31 60 CTTTGCCACCAGTGGAGTTC Chr2:30757260..30757279 60.69 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662813 Chr2:30758610..30758819 CTCACTCTCAGTCCCGGTGT Chr2:30758771..30758790 60.31 60
upstream ENSMUSE00000696302 Chr2:30757234..30757308 GAACTCCACTGGTGGCAAAG Chr2:30757282..30757301 60.69 55

*** Putative Vector Insertion (Chr 2: 30757233 - 30758820) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000401188 Chr2:30756387..30756469 TCCACATCTGGGTCACTCCT Chr2:30756377..30756396 60.53 55
downstream ENSMUSE00000568154 Chr2:30748118..30748346 GGGTCCCAGGAATGAGTACA Chr2:30748252..30748271 59.78 55
downstream ENSMUSE00000696303 Chr2:30748086..30748115 AGCTGCTGGTCACAGATGGT Chr2:30748066..30748085 60.89 55
downstream ENSMUSE00000662812 Chr2:30744995..30748346 CAGCCTAATGTTCAGCGACA Chr2:30746568..30746587 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCAGTCCCGGTGTTAATCG Chr2:30758763..30758783 60.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACCGCCTACTCAGGACTT Chr2:30758829..30758849 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050737