Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31574
Trapped Gene
Kcnb1 (ENSMUSG00000050556)
Vector Insertion
Chr 2: 166928887 - 167014300
Public Clones IST14814A11 (tigm) IST12385D3 (tigm) IST14814A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408583 (Chr2:167013557..167014299 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTCGAGGACAACGAGTA Chr2:167013876..167013895 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408583 (Chr2:167013557..167014299 -)
Downstram Exon
ENSMUSE00000376023 (Chr2:166928888..166931859 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTCGAGGACAACGAGTA Chr2:167013876..167013895 60.01 55 GCTCTCCACGAAGAAACCAG Chr2:166930440..166930459 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408583 Chr2:167013557..167014299 AGCCTCGAGGACAACGAGTA Chr2:167013876..167013895 60.01 55
upstream ENSMUSE00000376023 Chr2:166928888..166931859 CTGGTTTCTTCGTGGAGAGC Chr2:166930462..166930481 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:166987230..166987250 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCCGTGACTGGGAAAAC Chr2:166999234..166999254 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050556