Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31585
Trapped Gene
Scn3a (ENSMUSG00000057182)
Vector Insertion
Chr 2: 65302771 - 65305084
Public Clones IST11675D10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644955 (Chr2:65304979..65305083 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGAAACTTGGCTCCAAAA Chr2:65305008..65305028 59.85 38.1 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644955 (Chr2:65304979..65305083 -)
Downstram Exon
ENSMUSE00000602442 (Chr2:65302772..65303042 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGAAACTTGGCTCCAAAA Chr2:65305008..65305028 59.85 38.1 GTTCCAGCCAATCGTGAAGT Chr2:65302787..65302806 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691596 Chr2:65405323..65405684 TGCTGTCCTTTGTTGAGCTG Chr2:65405346..65405365 60.17 50
upstream ENSMUSE00000691631 Chr2:65405323..65405551 TGCTGTCCTTTGTTGAGCTG Chr2:65405346..65405365 60.17 50
upstream ENSMUSE00000710041 Chr2:65374470..65374783 CCTGGACCCCTACTACGTCA Chr2:65374478..65374497 59.98 60
upstream ENSMUSE00000713959 Chr2:65374470..65374783 CCTGGACCCCTACTACGTCA Chr2:65374478..65374497 59.98 60
upstream ENSMUSE00000721121 Chr2:65374470..65374783 CCTGGACCCCTACTACGTCA Chr2:65374478..65374497 59.98 60
upstream ENSMUSE00000566691 Chr2:65368861..65368979 AACCCCGTTAGGAAAATTGC Chr2:65368882..65368901 60.18 45
upstream ENSMUSE00000691592 Chr2:65368861..65368979 AACCCCGTTAGGAAAATTGC Chr2:65368882..65368901 60.18 45
upstream ENSMUSE00000691629 Chr2:65368860..65368979 AACCCCGTTAGGAAAATTGC Chr2:65368882..65368901 60.18 45
upstream ENSMUSE00000496069 Chr2:65367447..65367536 TCCTCCTGACTGGACGAAGA Chr2:65367454..65367473 60.94 55
upstream ENSMUSE00000691590 Chr2:65367447..65367536 TCCTCCTGACTGGACGAAGA Chr2:65367454..65367473 60.94 55
upstream ENSMUSE00000691627 Chr2:65367447..65367535 TCCTCCTGACTGGACGAAGA Chr2:65367454..65367473 60.94 55
upstream ENSMUSE00000602458 Chr2:65364554..65364682 TCTTCGTGACCCATGGAACT Chr2:65364582..65364601 60.51 50
upstream ENSMUSE00000691569 Chr2:65364554..65364684 TCTTCGTGACCCATGGAACT Chr2:65364582..65364601 60.51 50
upstream ENSMUSE00000691583 Chr2:65364554..65364682 TCTTCGTGACCCATGGAACT Chr2:65364582..65364601 60.51 50
upstream ENSMUSE00000691568 Chr2:65363934..65364025 GGCAATGTTTCAGCTCTTCG Chr2:65363981..65364000 60.91 50
upstream ENSMUSE00000602457 Chr2:65363752..65363843 TCTCCGAGCATTGAAAACAA Chr2:65363767..65363786 59.4 40
upstream ENSMUSE00000691582 Chr2:65363752..65363843 TCTCCGAGCATTGAAAACAA Chr2:65363767..65363786 59.4 40
upstream ENSMUSE00000356142 Chr2:65362661..65362933 TCTGAGCGTCTTTGCTCTCA Chr2:65362838..65362857 60.01 50
upstream ENSMUSE00000711582 Chr2:65362661..65362933 TCTGAGCGTCTTTGCTCTCA Chr2:65362838..65362857 60.01 50
upstream ENSMUSE00000719364 Chr2:65362661..65362933 TCTGAGCGTCTTTGCTCTCA Chr2:65362838..65362857 60.01 50
upstream ENSMUSE00000381484 Chr2:65362203..65362266 TTTTGGATGGACAAAAAGATCC Chr2:65362233..65362254 60.16 36.36
upstream ENSMUSE00000691581 Chr2:65362203..65362266 TTTTGGATGGACAAAAAGATCC Chr2:65362233..65362254 60.16 36.36
upstream ENSMUSE00000371666 Chr2:65359849..65359990 CGAAACCCCAACTACGGTTA Chr2:65359934..65359953 59.85 50
upstream ENSMUSE00000691580 Chr2:65359849..65359990 CGAAACCCCAACTACGGTTA Chr2:65359934..65359953 59.85 50
upstream ENSMUSE00000549937 Chr2:65358880..65359086 AAAATCAGGCCACACTGGAG Chr2:65358952..65358971 60.11 50
upstream ENSMUSE00000691624 Chr2:65358880..65359086 AAAATCAGGCCACACTGGAG Chr2:65358952..65358971 60.11 50
upstream ENSMUSE00000644949 Chr2:65352529..65352819 AGACAGAGGGAGCACTTGGA Chr2:65352662..65352681 59.99 55
upstream ENSMUSE00000644950 Chr2:65352529..65352819 AGACAGAGGGAGCACTTGGA Chr2:65352662..65352681 59.99 55
upstream ENSMUSE00000691588 Chr2:65346519..65346719 GTTTTCCCCAAGACGCAATA Chr2:65346674..65346693 59.94 45
upstream ENSMUSE00000691578 Chr2:65346342..65346719 GTTTTCCCCAAGACGCAATA Chr2:65346674..65346693 59.94 45
upstream ENSMUSE00000602379 Chr2:65346339..65346719 GTTTTCCCCAAGACGCAATA Chr2:65346674..65346693 59.94 45
upstream ENSMUSE00000691565 Chr2:65346334..65346719 GTTTTCCCCAAGACGCAATA Chr2:65346674..65346693 59.94 45
upstream ENSMUSE00000602454 Chr2:65345204..65345336 GAGCCATGAGCATAGCCAGT Chr2:65345226..65345245 60.39 55
upstream ENSMUSE00000691577 Chr2:65345204..65345339 GAGCCATGAGCATAGCCAGT Chr2:65345226..65345245 60.39 55
upstream ENSMUSE00000602453 Chr2:65344074..65344312 ATGGAGCACTACCCGATGAC Chr2:65344111..65344130 59.96 55
upstream ENSMUSE00000691621 Chr2:65344074..65344312 ATGGAGCACTACCCGATGAC Chr2:65344111..65344130 59.96 55
upstream ENSMUSE00000602452 Chr2:65336924..65337097 GTCTTCACCGGGATCTTCAC Chr2:65337078..65337097 59.51 55
upstream ENSMUSE00000691576 Chr2:65336924..65337097 GTCTTCACCGGGATCTTCAC Chr2:65337078..65337097 59.51 55
upstream ENSMUSE00000602451 Chr2:65335427..65335783 GTCTTCATTTTTGCCGTGGT Chr2:65335653..65335672 59.98 45
upstream ENSMUSE00000691573 Chr2:65335427..65335783 GTCTTCATTTTTGCCGTGGT Chr2:65335653..65335672 59.98 45
upstream ENSMUSE00000602450 Chr2:65332980..65333453 GAAATCCACGAAGGGAACAA Chr2:65333245..65333264 59.91 45
upstream ENSMUSE00000428905 Chr2:65332950..65333453 GAAATCCACGAAGGGAACAA Chr2:65333245..65333264 59.91 45
upstream ENSMUSE00000644951 Chr2:65332898..65332948 No primer for this exon
upstream ENSMUSE00000691614 Chr2:65322403..65322523 CCGAGAAGGTGAACAAGCTG Chr2:65322451..65322470 60.96 55
upstream ENSMUSE00000691612 Chr2:65321100..65321254 TGTGGAACACAACTGGTTTGA Chr2:65321143..65321163 60.03 42.86
upstream ENSMUSE00000691610 Chr2:65320208..65320381 ACATTGAGCAACGGAAGACC Chr2:65320346..65320365 60.12 50
upstream ENSMUSE00000691609 Chr2:65310336..65310458 AAATCCCTACGGACCCTGAG Chr2:65310382..65310401 60.32 55
upstream ENSMUSE00000691607 Chr2:65307983..65308255 CAATTTCAGCGACTGTCAGG Chr2:65308066..65308085 59.44 50
upstream ENSMUSE00000691604 Chr2:65307069..65307122 CATTCAAAGGCTGGATGGAT Chr2:65307099..65307118 59.89 45
upstream ENSMUSE00000467523 Chr2:65306124..65306261 TCTATTCATCGGCGTCATCA Chr2:65306153..65306172 60.18 45
upstream ENSMUSE00000644955 Chr2:65304979..65305083 TGAAGAAACTTGGCTCCAAAA Chr2:65305008..65305028 59.85 38.1
upstream ENSMUSE00000602442 Chr2:65302772..65303042 ACTTCACGATTGGCTGGAAC Chr2:65302809..65302828 60.12 50

*** Putative Vector Insertion (Chr 2: 65302771 - 65305084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644954 Chr2:65297922..65299794 TCAGGAGGTGCACTGTTGAG Chr2:65299406..65299425 60.02 55
downstream ENSMUSE00000691587 Chr2:65296320..65299794 TCAGGAGGTGCACTGTTGAG Chr2:65299406..65299425 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACATAATCGCCTTGCAGCAC Chr2:65305016..65305037 61.17 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGGTTGGGATTGTAACCA Chr2:65305101..65305122 60.65 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057182