Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3159
Trapped Gene
Abl1 (ENSMUSG00000026842)
Vector Insertion
Chr 2: 31640300 - 31645790
Public Clones XT0574 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000604208 (Chr2:31640027..31640299 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAGCCGCTTCAACACTCT Chr2:31640042..31640061 59.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000604208 (Chr2:31640027..31640299 +)
Downstram Exon
ENSMUSE00000604207 (Chr2:31645791..31645875 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAGCCGCTTCAACACTCT Chr2:31640042..31640061 59.75 55 CTGCACCAGGTTAGGGTGTT Chr2:31645871..31645890 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000478509 Chr2:31544833..31545462 ACTTTTGGCATTGCGGTTAC Chr2:31545076..31545095 60 45
upstream ENSMUSE00000695649 Chr2:31546219..31546279 AGCTGCACTTGAAACTTCTCG Chr2:31546247..31546267 59.81 47.62
upstream ENSMUSE00000352617 Chr2:31615500..31615635 CTTCGTCCTCCAGCTGCTAC Chr2:31615609..31615628 60.16 60
upstream ENSMUSE00000695641 Chr2:31615912..31615975 GGTGGACCTACACCAAGTGC Chr2:31615922..31615941 60.43 60
upstream ENSMUSE00000604210 Chr2:31633854..31634027 TGTGGCCAGTGGAGATAACA Chr2:31633990..31634009 60.11 50
upstream ENSMUSE00000604209 Chr2:31634441..31634736 TGTATCTCGGAATGCTGCTG Chr2:31634580..31634599 59.97 50
upstream ENSMUSE00000604208 Chr2:31640027..31640299 GAGAGCCGCTTCAACACTCT Chr2:31640042..31640061 59.75 55

*** Putative Vector Insertion (Chr 2: 31640300 - 31645790) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000604207 Chr2:31645791..31645875 CTGCACCAGGTTAGGGTGTT Chr2:31645871..31645890 60.03 55
downstream ENSMUSE00000604206 Chr2:31646182..31646359 CAGGTAGTCCAGCAGGTTCC Chr2:31646258..31646277 59.72 60
downstream ENSMUSE00000604205 Chr2:31647758..31647942 GTTGTAGGCCAGGCTCTCAG Chr2:31647917..31647936 60.01 60
downstream ENSMUSE00000604204 Chr2:31650062..31650214 GGTAGCAATCTCCCAGAGCA Chr2:31650096..31650115 60.36 55
downstream ENSMUSE00000604203 Chr2:31652493..31652582 TCAAAGGCTTGGTGGATTTC Chr2:31652553..31652572 60.05 45
downstream ENSMUSE00000604202 Chr2:31653083..31653247 CTCTCCTGCAGGTTCTGGTC Chr2:31653184..31653203 59.99 60
downstream ENSMUSE00000346836 Chr2:31655726..31659747 GGACTTGGTAGGCTCTGCTG Chr2:31656024..31656043 60.01 60
downstream ENSMUSE00000604211 Chr2:31655726..31659054 GGACTTGGTAGGCTCTGCTG Chr2:31656024..31656043 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCGTTTGGAAGAAGTACA Chr2:31640252..31640272 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCGTTTGGAAGAAGTACA Chr2:31640252..31640272 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026842