Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31590
Trapped Gene
Eya4 (ENSMUSG00000010461)
Vector Insertion
Chr 10: 22836625 - 22843748
Public Clones IST12426C10 (tigm) IST10509G2 (tigm) IST10419H3 (tigm) IST11541H8 (tigm)
IST10851A8 (tigm) IST14522F5 (tigm) IST11270E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644565 (Chr10:22843658..22843747 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644565 (Chr10:22843658..22843747 -)
Downstram Exon
ENSMUSE00000644564 (Chr10:22836626..22836684 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666550 Chr10:23069568..23069701 No primer for this exon
upstream ENSMUSE00000666549 Chr10:23042854..23042952 No primer for this exon
upstream ENSMUSE00000666548 Chr10:22946608..22946657 No primer for this exon
upstream ENSMUSE00000644575 Chr10:22892805..22892929 No primer for this exon
upstream ENSMUSE00000644573 Chr10:22883200..22883292 No primer for this exon
upstream ENSMUSE00000644572 Chr10:22878894..22878960 No primer for this exon
upstream ENSMUSE00000644571 Chr10:22877318..22877460 No primer for this exon
upstream ENSMUSE00000644570 Chr10:22877058..22877201 No primer for this exon
upstream ENSMUSE00000644569 Chr10:22875726..22875805 No primer for this exon
upstream ENSMUSE00000644568 Chr10:22871738..22871903 No primer for this exon
upstream ENSMUSE00000644567 Chr10:22859767..22859903 No primer for this exon
upstream ENSMUSE00000644566 Chr10:22857997..22858080 No primer for this exon
upstream ENSMUSE00000644565 Chr10:22843658..22843747 No primer for this exon
upstream ENSMUSE00000644564 Chr10:22836626..22836684 No primer for this exon

*** Putative Vector Insertion (Chr 10: 22836625 - 22843748) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644563 Chr10:22836359..22836519 No primer for this exon
downstream ENSMUSE00000644562 Chr10:22833716..22833830 No primer for this exon
downstream ENSMUSE00000644560 Chr10:22831366..22831487 No primer for this exon
downstream ENSMUSE00000615441 Chr10:22829777..22829877 No primer for this exon
downstream ENSMUSE00000577117 Chr10:22829638..22829738 No primer for this exon
downstream ENSMUSE00000491805 Chr10:22823974..22826094 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTGCCAGCCAGCTTCTTA Chr10:22840734..22840754 61.01 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAAGCTGGGAAATCGTGAC Chr10:22840691..22840711 59.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010461