Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31605
Trapped Gene
EG433481 (ENSMUSG00000074758)
Vector Insertion
Chr 2: 144004763 - 144015027
Public Clones IST10249H12 (tigm) IST13124D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682462 (Chr2:144014877..144015026 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATCTGCATGCCATTTTGA Chr2:144014882..144014901 59.23 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682462 (Chr2:144014877..144015026 -)
Downstram Exon
ENSMUSE00000640508 (Chr2:144004764..144004884 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATCTGCATGCCATTTTGA Chr2:144014882..144014901 59.23 40 ACTGTGGTCTCGGCAGAACT Chr2:144004807..144004826 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682462 Chr2:144014877..144015026 AGATCTGCATGCCATTTTGA Chr2:144014882..144014901 59.23 40
upstream ENSMUSE00000640508 Chr2:144004764..144004884 AGTTCTGCCGAGACCACAGT Chr2:144004829..144004848 59.91 55

*** Putative Vector Insertion (Chr 2: 144004763 - 144015027) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640506 Chr2:144000263..144000480 TGAGAAATGGTGCGTCTCTG Chr2:144000356..144000375 59.98 50
downstream ENSMUSE00000640505 Chr2:143998886..144000139 AGGGAGTTTCGACAGCTCAA Chr2:143999297..143999316 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCCCGGTTATGACCTATT Chr2:144015016..144015036 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCCCGGTTATGACCTATT Chr2:144015016..144015036 59.69 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074758