Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31609
Trapped Gene
Rhpn2 (ENSMUSG00000030494)
Vector Insertion
Chr 7: 36119431 - 36138750
Public Clones IST14165G4 (tigm) IST14549A7 (tigm) IST13075D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000596560 (Chr7:36119333..36119430 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGACCGATACGCTGCTACC Chr7:36119362..36119381 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000596560 (Chr7:36119333..36119430 +)
Downstram Exon
ENSMUSE00000518772 (Chr7:36138751..36138866 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGACCGATACGCTGCTACC Chr7:36119362..36119381 60.12 55 AGAAGGTTCTCGGCTCCTGT Chr7:36138866..36138885 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000596560 Chr7:36119333..36119430 ATGACCGATACGCTGCTACC Chr7:36119362..36119381 60.12 55
upstream ENSMUSE00000596559 Chr7:36119343..36119430 ATGACCGATACGCTGCTACC Chr7:36119362..36119381 60.12 55

*** Putative Vector Insertion (Chr 7: 36119431 - 36138750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000518772 Chr7:36138751..36138866 AGAAGGTTCTCGGCTCCTGT Chr7:36138866..36138885 60.39 55
downstream ENSMUSE00000514886 Chr7:36145999..36146127 ACTCCCACGGAGATGTTGAG Chr7:36146115..36146134 60.11 55
downstream ENSMUSE00000516669 Chr7:36148636..36148711 No primer for this exon
downstream ENSMUSE00000199777 Chr7:36155728..36155805 CTGTCGCAGGTCCATAAGGT Chr7:36155808..36155827 60.13 55
downstream ENSMUSE00000199767 Chr7:36156134..36156258 GCCCAGCTGAATGAAGTACG Chr7:36156205..36156224 60.8 55
downstream ENSMUSE00000297094 Chr7:36157324..36157490 ATCCACAGCGCTCTCTAAGC Chr7:36157474..36157493 59.75 55
downstream ENSMUSE00000297087 Chr7:36161179..36161366 GCAGGGCTCATGTCGTAACT Chr7:36161242..36161261 60.28 55
downstream ENSMUSE00000297078 Chr7:36161993..36162149 CCACGAATACGGGATGTTCT Chr7:36162070..36162089 59.81 50
downstream ENSMUSE00000199769 Chr7:36164584..36164703 TCTCTTGGTGGTCCTCGTCT Chr7:36164619..36164638 59.83 55
downstream ENSMUSE00000199768 Chr7:36166356..36166550 ATCTGGAGCGTCAATCAGGT Chr7:36166546..36166565 59.69 50
downstream ENSMUSE00000297055 Chr7:36168988..36169064 GGAAAAGTCGGGGAAGGTTA Chr7:36169034..36169053 60.29 50
downstream ENSMUSE00000297049 Chr7:36169657..36169803 GGTGTTCCCTCGTAAGGTGA Chr7:36169764..36169783 59.97 55
downstream ENSMUSE00000199773 Chr7:36170346..36170501 GAGGCTCACGACCTTCATCT Chr7:36170483..36170502 59.41 55
downstream ENSMUSE00000442866 Chr7:36175774..36177304 GGTCACCAGGGCAACTTCTA Chr7:36176338..36176357 60.11 55
downstream ENSMUSE00000533307 Chr7:36175774..36176329 AGAGTTGAGCAGGCTGAAGG Chr7:36176019..36176038 59.74 55
downstream ENSMUSE00000533306 Chr7:36176628..36177300 CAGCCTGTTTCGGTTTTGTT Chr7:36176708..36176727 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTATGGCTAATCGCCTTGC Chr7:36128474..36128494 60.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCTTGGAATCCGTGACTG Chr7:36134470..36134490 61.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030494