Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31610
Trapped Gene
Mzf1 (ENSMUSG00000030380)
Vector Insertion
Chr 7: 13627709 - 13636961
Public Clones IST14935C1 (tigm) IST12840B9 (tigm) IST10255G7 (tigm) IST14945F7 (tigm)
IST14661G12 (tigm) IST10255F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000198112 (Chr7:13636840..13636960 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATAGCGACACTGAGCCTGA Chr7:13636908..13636927 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000198112 (Chr7:13636840..13636960 -)
Downstram Exon
ENSMUSE00000459266 (Chr7:13627710..13630049 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATAGCGACACTGAGCCTGA Chr7:13636908..13636927 60.16 55 CTGTCCATCTGCAGCGTAAA Chr7:13630006..13630025 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000521110 Chr7:13639830..13639993 GAAGAGACGTCCAGGAGTGC Chr7:13639877..13639896 59.99 60
upstream ENSMUSE00000198118 Chr7:13638092..13638727 AGGACTCTGACAGCGACGAT Chr7:13638401..13638420 60.02 55
upstream ENSMUSE00000459284 Chr7:13638092..13638530 AGGACTCTGACAGCGACGAT Chr7:13638401..13638420 60.02 55
upstream ENSMUSE00000198141 Chr7:13637532..13637715 CAGGAATTGCCACTGAACCT Chr7:13637570..13637589 60.11 50
upstream ENSMUSE00000198136 Chr7:13637082..13637152 CTGCAGCCACTCTCCTACCT Chr7:13637094..13637113 59.62 60
upstream ENSMUSE00000198112 Chr7:13636840..13636960 CATAGCGACACTGAGCCTGA Chr7:13636908..13636927 60.16 55
upstream ENSMUSE00000459266 Chr7:13627710..13630049 TTTACGCTGCAGATGGACAG Chr7:13630028..13630047 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGACAACACTGGACCAGAC Chr7:13636933..13636953 60.42 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGACAACACTGGACCAGAC Chr7:13636933..13636953 60.42 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030380