Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3163
Trapped Gene
Atp13a1 (ENSMUSG00000031862)
Vector Insertion
Chr 8: 72322832 - 72323219
Public Clones XT0382 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214020 (Chr8:72322711..72322831 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCTTTGACAAGACGGGTA Chr8:72322766..72322785 59.32 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214020 (Chr8:72322711..72322831 +)
Downstram Exon
ENSMUSE00000214014 (Chr8:72323220..72323377 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCTTTGACAAGACGGGTA Chr8:72322766..72322785 59.32 45 TTTGGTCAGTGTCCAGTCCA Chr8:72323379..72323398 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000236766 Chr8:72315149..72315540 GCACGCACTCACTGTCCTGT Chr8:72315474..72315493 62.58 60
upstream ENSMUSE00000214015 Chr8:72317648..72317737 AATGGCTCCACTGAGCTTGT Chr8:72317699..72317718 59.87 50
upstream ENSMUSE00000426440 Chr8:72317829..72318019 AGATCCGAGCTGCAGAGAAG Chr8:72317983..72318002 59.85 55
upstream ENSMUSE00000236751 Chr8:72320478..72320550 CCCCTTTCTTCGTGTTTCAG Chr8:72320531..72320550 59.71 50
upstream ENSMUSE00000214027 Chr8:72320729..72320884 CTGGTGCCTGGACGAGTATT Chr8:72320746..72320765 60.13 55
upstream ENSMUSE00000214033 Chr8:72320981..72321050 CTGTCGCCAGTGATGACATT Chr8:72321006..72321025 59.71 50
upstream ENSMUSE00000683062 Chr8:72320981..72321058 CTGTCGCCAGTGATGACATT Chr8:72321006..72321025 59.71 50
upstream ENSMUSE00000214016 Chr8:72321124..72321230 ATTGTAGACGAGGCCATGCT Chr8:72321183..72321202 59.72 50
upstream ENSMUSE00000214031 Chr8:72321606..72321735 CACCAAGGTGGTACAGCACA Chr8:72321683..72321702 60.63 55
upstream ENSMUSE00000214035 Chr8:72321840..72321895 GGCCTTTGTCCTGAGAACTG Chr8:72321859..72321878 59.84 55
upstream ENSMUSE00000683061 Chr8:72322283..72322412 TGGGGTAAAGAGGGTCACTG Chr8:72322312..72322331 59.96 55
upstream ENSMUSE00000214024 Chr8:72322286..72322412 TGGGGTAAAGAGGGTCACTG Chr8:72322312..72322331 59.96 55
upstream ENSMUSE00000214021 Chr8:72322483..72322620 CCTCTGTTGTACCCCCTGAA Chr8:72322543..72322562 59.96 55
upstream ENSMUSE00000214020 Chr8:72322711..72322831 TTGCTTTGACAAGACGGGTA Chr8:72322766..72322785 59.32 45

*** Putative Vector Insertion (Chr 8: 72322832 - 72323219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214014 Chr8:72323220..72323377 TTTGGTCAGTGTCCAGTCCA Chr8:72323379..72323398 60.13 50
downstream ENSMUSE00000214012 Chr8:72323661..72323836 ACATTCGCTTTAGGGCACTG Chr8:72323750..72323769 60.27 50
downstream ENSMUSE00000214034 Chr8:72323911..72324021 TTGTATCCCAGAGCCAGGAC Chr8:72323996..72324015 60.07 55
downstream ENSMUSE00000214025 Chr8:72324801..72324926 ACAGGAGACCACGATGAAGC Chr8:72324872..72324891 60.27 55
downstream ENSMUSE00000214013 Chr8:72325933..72326041 TGTGGGCTTTGTCAATGAAG Chr8:72326014..72326033 59.69 45
downstream ENSMUSE00000214019 Chr8:72327359..72327558 AGGCAGAACGATGCTGCTAT Chr8:72327408..72327427 60.01 50
downstream ENSMUSE00000214022 Chr8:72327639..72327735 CCAGCTCCTTCAGGCTAGTG Chr8:72327672..72327691 60.15 60
downstream ENSMUSE00000214023 Chr8:72329119..72329276 AGTGCCGACTTCTGTTTGGT Chr8:72329245..72329264 59.77 50
downstream ENSMUSE00000214036 Chr8:72329347..72329461 CACTGGATGGAGGACAGCTT Chr8:72329462..72329481 60.26 55
downstream ENSMUSE00000214030 Chr8:72329545..72329741 ACTTTGGCTGTATGCCAGGA Chr8:72329648..72329667 60.66 50
downstream ENSMUSE00000214018 Chr8:72330660..72330802 GGCCTCACGGTACAGGTAGA Chr8:72330785..72330804 60.13 60
downstream ENSMUSE00000214032 Chr8:72330896..72331007 TGTAGTTGATGGCGAAGGTG Chr8:72331008..72331027 59.72 50
downstream ENSMUSE00000236604 Chr8:72331091..72331234 GATGTCCACAAGGCCAAACT Chr8:72331228..72331247 59.97 50
downstream ENSMUSE00000426456 Chr8:72331318..72331637 CTCAGGAAGGCACTCTCAGC Chr8:72331432..72331451 60.28 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGCTGAGGTGAGCATAA Chr8:72322823..72322843 61.34 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTCGTGACTGGGAAAAC Chr8:72322878..72322898 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031862