Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31645
Trapped Gene
Hmcn1 (ENSMUSG00000066842)
Vector Insertion
Chr 1: 152666488 - 152706392
Public Clones IST12050C3 (tigm) IST13076H3 (tigm) IST10922D6 (tigm) IST14026C9 (tigm)
IST10922D6 (tigm) IST14430C2 (tigm) IST10879B2 (tigm) IST14995C8 (tigm)
IST13081D5 (tigm) IST14976F8 (tigm) IST13059B10 (tigm) IST13055B2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689592 (Chr1:152706269..152706391 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCATCTGGACAAAAAGCA Chr1:152706279..152706298 59.25 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689592 (Chr1:152706269..152706391 -)
Downstram Exon
ENSMUSE00000689591 (Chr1:152666489..152666660 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCATCTGGACAAAAAGCA Chr1:152706279..152706298 59.25 40 AATCTCAATCACGGGAGACG Chr1:152666480..152666499 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000595421 Chr1:152839914..152840565 GGGTTGGTCTGCATCTCATT Chr1:152840344..152840363 59.93 50
upstream ENSMUSE00000721612 Chr1:152839914..152840565 GGGTTGGTCTGCATCTCATT Chr1:152840344..152840363 59.93 50
upstream ENSMUSE00000689595 Chr1:152723555..152723625 No primer for this exon
upstream ENSMUSE00000595420 Chr1:152720878..152723625 CGGCTCTAGAGGATGGAGTG Chr1:152721442..152721461 59.97 60
upstream ENSMUSE00000689594 Chr1:152707349..152707507 TTTTCACTGATGCACGATCC Chr1:152707406..152707425 59.65 45
upstream ENSMUSE00000689592 Chr1:152706269..152706391 TTCCATCTGGACAAAAAGCA Chr1:152706279..152706298 59.25 40
upstream ENSMUSE00000689591 Chr1:152666489..152666660 CGTCTCCCGTGATTGAGATT Chr1:152666502..152666521 60.07 50

*** Putative Vector Insertion (Chr 1: 152666488 - 152706392) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689589 Chr1:152664151..152664257 ATTCAGGCCAAATCCCTTTT Chr1:152664204..152664223 59.78 40
downstream ENSMUSE00000689588 Chr1:152656817..152656937 TGAGACCGGTGATACGAACA Chr1:152656873..152656892 60.11 50
downstream ENSMUSE00000689586 Chr1:152655663..152655926 AGGCTTCCGATCTGGGTAAT Chr1:152655771..152655790 59.92 50
downstream ENSMUSE00000689584 Chr1:152653498..152653642 GCCTGGCTGCAGGTAGTATC Chr1:152653565..152653584 59.87 60
downstream ENSMUSE00000689582 Chr1:152649947..152650068 GCTGCTCACAGCGATACAGT Chr1:152649965..152649984 59.22 55
downstream ENSMUSE00000689581 Chr1:152645852..152646127 TCGGATATCTCTGCCACTCC Chr1:152645975..152645994 60.18 55
downstream ENSMUSE00000689580 Chr1:152620894..152621035 CCAGACAATCTTCGGTTTGG Chr1:152620907..152620926 60.49 50
downstream ENSMUSE00000689578 Chr1:152619566..152619693 AAGCGTAGGTCCCTGCATCT Chr1:152619601..152619620 61.17 55
downstream ENSMUSE00000689577 Chr1:152617364..152617477 AGGTGGAGGAATCCCAGAAG Chr1:152617361..152617380 60.45 55
downstream ENSMUSE00000689576 Chr1:152612487..152612645 GTCCCACGAGAGGGTCAATA Chr1:152612570..152612589 59.93 55
downstream ENSMUSE00000260072 Chr1:152605398..152605592 CAGCCTACGCCATTTGATCT Chr1:152605455..152605474 60.24 50
downstream ENSMUSE00000159703 Chr1:152603653..152603748 CCGTTACTGTTGTCTGCGACT Chr1:152603643..152603663 60.36 52.38
downstream ENSMUSE00000159721 Chr1:152602386..152602513 TGGAAGGGCTGATTCCAATA Chr1:152602462..152602481 60.4 45
downstream ENSMUSE00000159744 Chr1:152600700..152600844 GCTGCGCACAGTTATGTAGG Chr1:152600790..152600809 59.52 55
downstream ENSMUSE00000159819 Chr1:152597781..152597893 GAACGCCTTCAATTGTGCTC Chr1:152597818..152597837 60.79 50
downstream ENSMUSE00000260248 Chr1:152596075..152596234 AAAACTTGGCACTGCTCGTT Chr1:152596176..152596195 59.92 45
downstream ENSMUSE00000260235 Chr1:152595302..152595470 TCTTTGGTCCCCAAACACTC Chr1:152595420..152595439 59.94 50
downstream ENSMUSE00000689572 Chr1:152592083..152592210 CAGAAGGGAGGAACGTGTGT Chr1:152592169..152592188 60.15 55
downstream ENSMUSE00000689570 Chr1:152590717..152590986 CTTGGACATGCAATGTGACC Chr1:152590695..152590714 59.97 50
downstream ENSMUSE00000689569 Chr1:152589394..152589489 AGGTTGCAGGTCTTCCACTG Chr1:152589439..152589458 60.3 55
downstream ENSMUSE00000689567 Chr1:152585718..152585912 GTGGTCCCAGCTTCATTGAC Chr1:152585725..152585744 60.52 55
downstream ENSMUSE00000689566 Chr1:152584608..152584738 AGGGGACGGAGTTCCTTCTA Chr1:152584616..152584635 60.07 55
downstream ENSMUSE00000689564 Chr1:152584312..152584459 AGGAATATCTTCCCGCATCC Chr1:152584347..152584366 60.25 50
downstream ENSMUSE00000689563 Chr1:152581575..152581701 AACCAGTGAATAGCCGGAAA Chr1:152581565..152581584 59.57 45
downstream ENSMUSE00000689561 Chr1:152579933..152580087 CATTGGTAGCGTCCCTTGTC Chr1:152579967..152579986 60.52 55
downstream ENSMUSE00000689560 Chr1:152570388..152570666 CCTGGCCATCCTTATACCAA Chr1:152570516..152570535 59.78 50
downstream ENSMUSE00000689558 Chr1:152569492..152569773 CGGTCAAGTCACCTTCGATT Chr1:152569722..152569741 60.11 50
downstream ENSMUSE00000689557 Chr1:152568743..152568851 TGATAGTTGGTGGGGGAGAG Chr1:152568722..152568741 59.92 55
downstream ENSMUSE00000689555 Chr1:152567747..152567916 CAATAACGAGTTTGCGTCCA Chr1:152567818..152567837 59.73 45
downstream ENSMUSE00000689554 Chr1:152566225..152566379 ACAGGCTGGTCATCCTTCAG Chr1:152566228..152566247 60.26 55
downstream ENSMUSE00000689553 Chr1:152562831..152562954 GCAGTTGAGTGTGCTGGTGT Chr1:152562818..152562837 59.95 55
downstream ENSMUSE00000689552 Chr1:152551267..152551368 GGGGTTATTCACCACCACTG Chr1:152551285..152551304 60.09 55
downstream ENSMUSE00000689551 Chr1:152550299..152550475 GAGCACTCCCAATCTCAAGG Chr1:152550361..152550380 59.8 55
downstream ENSMUSE00000689550 Chr1:152548962..152549113 CCACCATGGAACTGCTACCT Chr1:152549056..152549075 59.99 55
downstream ENSMUSE00000689549 Chr1:152547567..152547690 ACCTTCCTGCGTCACTCATC Chr1:152547608..152547627 60.27 55
downstream ENSMUSE00000689548 Chr1:152544550..152544725 CCAATGAGGACGGAGACATT Chr1:152544655..152544674 59.93 50
downstream ENSMUSE00000689547 Chr1:152541954..152542063 CAACATTGGTGGCTTCACAG Chr1:152541984..152542003 60.15 50
downstream ENSMUSE00000689546 Chr1:152537684..152537796 GGCTGTAAGTTGCACAAGCTC Chr1:152537738..152537758 60.07 52.38
downstream ENSMUSE00000689545 Chr1:152536646..152536807 GAACACGTCCTGCAGAGTCA Chr1:152536750..152536769 60.03 55
downstream ENSMUSE00000689544 Chr1:152533795..152534076 CTTTTCCCACGGATGACAGT Chr1:152533991..152534010 59.97 50
downstream ENSMUSE00000689543 Chr1:152530720..152530887 TCCACCACACTGACGTTCTC Chr1:152530811..152530830 59.71 55
downstream ENSMUSE00000689542 Chr1:152527741..152527854 TGTCTTCACCAGCTGCATTC Chr1:152527746..152527765 59.99 50
downstream ENSMUSE00000689540 Chr1:152526639..152526725 CCAATGTGTTCTCACCCACA Chr1:152526671..152526690 60.42 50
downstream ENSMUSE00000689538 Chr1:152524366..152524557 TTGGAGAAGCTGTCCGTCTT Chr1:152524486..152524505 59.99 50
downstream ENSMUSE00000689537 Chr1:152523106..152523279 TTCTAAAGGTGTGCCGTCCT Chr1:152523112..152523131 59.73 50
downstream ENSMUSE00000689536 Chr1:152522643..152522756 ATTGTCTTCCTGCGCGTTTA Chr1:152522694..152522713 60.77 45
downstream ENSMUSE00000689535 Chr1:152521426..152521571 CCAAGAGGTCCCCTTTCTTG Chr1:152521517..152521536 60.98 55
downstream ENSMUSE00000689534 Chr1:152519042..152519192 CTGCAAGGTTAGATGCCACA Chr1:152519056..152519075 59.86 50
downstream ENSMUSE00000689533 Chr1:152516503..152516697 CTTTAGCTTCACCGCTCCTG Chr1:152516604..152516623 60.15 55
downstream ENSMUSE00000689532 Chr1:152514957..152515070 TCCCGGCATCTTCTACCTTA Chr1:152515001..152515020 59.66 50
downstream ENSMUSE00000689531 Chr1:152511903..152512090 GTGCTGGGTTACCACTGGAT Chr1:152511964..152511983 59.85 55
downstream ENSMUSE00000689530 Chr1:152510988..152511084 TGTTCTCTGCGACACACACA Chr1:152511008..152511027 60.07 50
downstream ENSMUSE00000689529 Chr1:152505609..152505770 CACGGTGAGAACATTCGTGT Chr1:152505591..152505610 59.6 50
downstream ENSMUSE00000689528 Chr1:152504508..152504621 CTTGGCCCGGATAATCTGTA Chr1:152504568..152504587 59.92 50
downstream ENSMUSE00000689527 Chr1:152504201..152504403 CTCGGCTCGTCTGATGTGTA Chr1:152504179..152504198 60.01 55
downstream ENSMUSE00000689525 Chr1:152503823..152503904 No primer for this exon
downstream ENSMUSE00000689524 Chr1:152503584..152503715 GTTTCCGGCCCTTCAATAGT Chr1:152503666..152503685 60.32 50
downstream ENSMUSE00000689523 Chr1:152502923..152503072 TCCACTGTTTGAACGCTGAG Chr1:152502968..152502987 60.03 50
downstream ENSMUSE00000689522 Chr1:152499642..152499801 CGCCATTCACTATGGGTTTT Chr1:152499636..152499655 59.82 45
downstream ENSMUSE00000689521 Chr1:152497092..152497216 TGTCAGATGTGAGGGCTCTG Chr1:152497142..152497161 59.98 55
downstream ENSMUSE00000689520 Chr1:152496709..152496892 CCGTTCTTCAGCCAGTTGAT Chr1:152496744..152496763 60.26 50
downstream ENSMUSE00000689519 Chr1:152496017..152496114 AGCTCTATTGGAGGCCACAC Chr1:152496032..152496051 59.31 55
downstream ENSMUSE00000689518 Chr1:152493708..152493986 CATTGCGTTGTCCATATTCG Chr1:152493939..152493958 59.95 45
downstream ENSMUSE00000689517 Chr1:152485983..152486179 GTGCACTGGACACTCGAAGA Chr1:152485963..152485982 60.03 55
downstream ENSMUSE00000689516 Chr1:152482252..152482333 GATGCCAGGCAGGTGTATCT Chr1:152482277..152482296 60.1 55
downstream ENSMUSE00000689515 Chr1:152480740..152480876 CCACATGATCACAGGTGGAG Chr1:152480742..152480761 59.95 55
downstream ENSMUSE00000689514 Chr1:152479536..152479677 TGTAGTCTTTCCCGCGATGT Chr1:152479539..152479558 60.66 50
downstream ENSMUSE00000689513 Chr1:152478297..152478441 CTAGCACAACGCCATCCTTT Chr1:152478291..152478310 60.27 50
downstream ENSMUSE00000689512 Chr1:152477784..152477911 ACATTGGTCGCCATACACAA Chr1:152477803..152477822 59.85 45
downstream ENSMUSE00000689510 Chr1:152477346..152477502 ACCCATAGCAATCGATGGAG Chr1:152477458..152477477 59.92 50
downstream ENSMUSE00000689509 Chr1:152474503..152474624 GGTCCACTGCTCTCTTGTCC Chr1:152474493..152474512 59.84 60
downstream ENSMUSE00000689508 Chr1:152474160..152474324 ATCCGATAGCCGTCTCCTCT Chr1:152474149..152474168 60.2 55
downstream ENSMUSE00000689507 Chr1:152471617..152471724 GCTGCATTACGAGCAACACA Chr1:152471633..152471652 61.02 50
downstream ENSMUSE00000689506 Chr1:152470294..152470431 No primer for this exon
downstream ENSMUSE00000689505 Chr1:152470031..152470165 GCTGCCACTAGGAAGAATGG Chr1:152470112..152470131 59.84 55
downstream ENSMUSE00000689504 Chr1:152465971..152466240 CTGGCGGATAGATTCGGTAA Chr1:152466073..152466092 60.05 50
downstream ENSMUSE00000689477 Chr1:152462240..152462282 TTTCCAAGATGAGCTCTCCA Chr1:152462226..152462245 58.51 45
downstream ENSMUSE00000689503 Chr1:152462240..152462430 TTCTCGTTGACGGTGAAGTG Chr1:152462360..152462379 59.87 50
downstream ENSMUSE00000689476 Chr1:152459757..152459970 GATGCCAACGGCTTTACAAC Chr1:152459781..152459800 60.51 50
downstream ENSMUSE00000689502 Chr1:152459757..152459970 GATGCCAACGGCTTTACAAC Chr1:152459781..152459800 60.51 50
downstream ENSMUSE00000689501 Chr1:152457748..152457882 ACAAATCCGATCGCTTTCAC Chr1:152457737..152457756 60.08 45
downstream ENSMUSE00000689500 Chr1:152456753..152456943 CCGAGTGGTTCAATCCAGTT Chr1:152456870..152456889 59.97 50
downstream ENSMUSE00000159739 Chr1:152454419..152454500 CCTCATTGGCAGCTACACAG Chr1:152454436..152454455 59.47 55
downstream ENSMUSE00000475795 Chr1:152451975..152452244 CGAGCAGCAGCGATGTATAA Chr1:152452036..152452055 60.14 50
downstream ENSMUSE00000159747 Chr1:152451226..152451396 CAGGCAGACCACAATGAAAA Chr1:152451344..152451363 59.69 45
downstream ENSMUSE00000159714 Chr1:152450921..152451091 TGCTGCAAGTTCTCGTCCTA Chr1:152450980..152450999 59.74 50
downstream ENSMUSE00000159725 Chr1:152446611..152446781 GCAGACTTGCATCTGGGTTT Chr1:152446608..152446627 60.26 50
downstream ENSMUSE00000159778 Chr1:152446002..152446172 CTCTGGACACCAGTCCCTTC Chr1:152446009..152446028 59.68 60
downstream ENSMUSE00000159821 Chr1:152445386..152445556 No primer for this exon
downstream ENSMUSE00000159824 Chr1:152445066..152445236 AGGAACGGCCACCTTTAGTT Chr1:152445095..152445114 60 50
downstream ENSMUSE00000159679 Chr1:152442977..152443126 GGAAAGCGATTCCAAACTCA Chr1:152443036..152443055 60.19 45
downstream ENSMUSE00000159687 Chr1:152442249..152442386 GCTTCCCCTATTTCCTTTGC Chr1:152442292..152442311 60.04 50
downstream ENSMUSE00000159775 Chr1:152441042..152441163 CTTCACACCGACTTCAGCAG Chr1:152441020..152441039 59.62 55
downstream ENSMUSE00000159754 Chr1:152440086..152440323 CATCGATGGTGAACAGACGA Chr1:152440226..152440245 60.69 50
downstream ENSMUSE00000159820 Chr1:152435342..152435404 AAAAGGGTCCAACCGAGTCT Chr1:152435326..152435345 59.97 50
downstream ENSMUSE00000159675 Chr1:152434079..152434198 GCATTGTGGCAGGTATGAGA Chr1:152434125..152434144 59.68 50
downstream ENSMUSE00000159699 Chr1:152433485..152433619 GCGATAGGATCCAATGGTGT Chr1:152433521..152433540 59.78 50
downstream ENSMUSE00000159818 Chr1:152430297..152430410 GTTGAAACATCGCTGGTGAC Chr1:152430339..152430358 59.14 50
downstream ENSMUSE00000159782 Chr1:152429353..152429478 AGCCTTGGTCATTCCACTTG Chr1:152429350..152429369 60.11 50
downstream ENSMUSE00000483421 Chr1:152427358..152427486 GGTAGCTGCCTCTCGTGTTC Chr1:152427390..152427409 60.02 60
downstream ENSMUSE00000467215 Chr1:152424402..152424752 TGTCTGTAATGCTGCGAAGG Chr1:152424505..152424524 60.01 50
downstream ENSMUSE00000159697 Chr1:152420606..152420725 TAGCTCCCGATCGTGTTTTT Chr1:152420640..152420659 59.71 45
downstream ENSMUSE00000159808 Chr1:152412447..152412573 CAGGATCCCGTTGGTAGTTG Chr1:152412432..152412451 60.37 55
downstream ENSMUSE00000367621 Chr1:152410657..152411023 CCAGCCGGATTAAATCTTGA Chr1:152410880..152410899 60.03 45
downstream ENSMUSE00000595395 Chr1:152409654..152411023 CCAGCCGGATTAAATCTTGA Chr1:152410880..152410899 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACCTGGAAACTTGGAAACA Chr1:152667348..152667369 59.99 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCTGGAAACTTGGAAACA Chr1:152667348..152667369 59.99 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066842