Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31646
Trapped Gene
Fgfr4 (ENSMUSG00000005320)
Vector Insertion
Chr 13: 55267648 - 55268218
Public Clones IST11206H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682232 (Chr13:55267585..55267647 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682232 (Chr13:55267585..55267647 +)
Downstram Exon
ENSMUSE00000118231 (Chr13:55268219..55268341 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401407 Chr13:55254001..55254288 No primer for this exon
upstream ENSMUSE00000118218 Chr13:55256799..55256932 No primer for this exon
upstream ENSMUSE00000118224 Chr13:55257592..55257855 No primer for this exon
upstream ENSMUSE00000118223 Chr13:55257947..55258027 No primer for this exon
upstream ENSMUSE00000118230 Chr13:55258135..55258301 No primer for this exon
upstream ENSMUSE00000615164 Chr13:55260455..55260578 No primer for this exon
upstream ENSMUSE00000615163 Chr13:55261284..55261474 No primer for this exon
upstream ENSMUSE00000118236 Chr13:55261610..55261748 No primer for this exon
upstream ENSMUSE00000118219 Chr13:55262477..55262670 No primer for this exon
upstream ENSMUSE00000615161 Chr13:55262755..55262900 No primer for this exon
upstream ENSMUSE00000615160 Chr13:55262983..55263104 No primer for this exon
upstream ENSMUSE00000118235 Chr13:55267251..55267361 No primer for this exon
upstream ENSMUSE00000118216 Chr13:55267457..55267647 No primer for this exon
upstream ENSMUSE00000682232 Chr13:55267585..55267647 No primer for this exon

*** Putative Vector Insertion (Chr 13: 55267648 - 55268218) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000118231 Chr13:55268219..55268341 No primer for this exon
downstream ENSMUSE00000682231 Chr13:55268219..55268341 No primer for this exon
downstream ENSMUSE00000570933 Chr13:55268449..55268519 No primer for this exon
downstream ENSMUSE00000682230 Chr13:55268449..55268519 No primer for this exon
downstream ENSMUSE00000118234 Chr13:55268761..55268898 No primer for this exon
downstream ENSMUSE00000682229 Chr13:55268761..55268898 No primer for this exon
downstream ENSMUSE00000118210 Chr13:55269167..55269272 No primer for this exon
downstream ENSMUSE00000641804 Chr13:55269356..55269367 No primer for this exon
downstream ENSMUSE00000380566 Chr13:55269387..55270094 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACACCTTCTTGCTGGGGTAA Chr13:55267682..55267702 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCGGAAGGTGTGGACAAAG Chr13:55267641..55267661 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005320