Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31647
Trapped Gene
Agpat5 (ENSMUSG00000031467)
Vector Insertion
Chr 8: 18846779 - 18861476
Public Clones (sanger) (ggtc) IST14972H1 (tigm) IST11033A1 (tigm) IST10830D5 (tigm)
IST10261B2 (tigm) IST10928H10 (tigm) IST11206H5 (tigm) IST14183G9 (tigm)
IST11033A1 (tigm) IST13606B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225997 (Chr8:18846537..18846778 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCGGCTTTACTGCGTCTA Chr8:18846713..18846732 60.41 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225997 (Chr8:18846537..18846778 +)
Downstram Exon
ENSMUSE00000209760 (Chr8:18861477..18861546 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCGGCTTTACTGCGTCTA Chr8:18846713..18846732 60.41 55 TTTGGCAAATCTCCATATAGCA Chr8:18861503..18861524 59.59 36.36

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000225997 Chr8:18846537..18846778 GACCGGCTTTACTGCGTCTA Chr8:18846713..18846732 60.41 55

*** Putative Vector Insertion (Chr 8: 18846779 - 18861476) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209760 Chr8:18861477..18861546 TTTGGCAAATCTCCATATAGCA Chr8:18861503..18861524 59.59 36.36
downstream ENSMUSE00000209756 Chr8:18868893..18869008 CATACAGCGGAAGCCATTTT Chr8:18868994..18869013 60.1 45
downstream ENSMUSE00000209754 Chr8:18870838..18870927 TGTTCCTGCGTTCACATAGC Chr8:18870927..18870946 59.87 50
downstream ENSMUSE00000209766 Chr8:18876040..18876130 AATGCCTGACTGGCTGAAAG Chr8:18876119..18876138 60.4 50
downstream ENSMUSE00000209767 Chr8:18878007..18878168 GCAACGTGAGTGGCCTTTAT Chr8:18878064..18878083 60.14 50
downstream ENSMUSE00000209762 Chr8:18879605..18879728 AAGTTTTGGGCACTGTTTGC Chr8:18879636..18879655 60.15 45
downstream ENSMUSE00000209758 Chr8:18881738..18881972 GGGTTCCATACAACCAGGTG Chr8:18881931..18881950 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGATCTAATCGCCTTGCAG Chr8:18858824..18858844 61.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTTCGTGACTGGGAAAA Chr8:18858824..18858844 58.41 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031467