Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31653
Trapped Gene
Dido1 (ENSMUSG00000038914)
Vector Insertion
Chr 2: 180408179 - 180409556
Public Clones IST14311D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638590 (Chr2:180409396..180409555 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCAAATATCGCAGCATCA Chr2:180409425..180409444 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638590 (Chr2:180409396..180409555 -)
Downstram Exon
ENSMUSE00000638589 (Chr2:180408180..180408296 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCAAATATCGCAGCATCA Chr2:180409425..180409444 59.94 45 TTCTCGAAGAACACGATGGA Chr2:180408248..180408267 59.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462163 Chr2:180444615..180444704 GGGGATGGAGACGTGTAGACT Chr2:180444630..180444650 60.39 57.14
upstream ENSMUSE00000546158 Chr2:180436666..180436805 CGGTAGTCTCGCTGGTCTCT Chr2:180436718..180436737 59.62 60
upstream ENSMUSE00000170674 Chr2:180426569..180426753 CCTTTGGTTGTTCGAAGCTC Chr2:180426704..180426723 59.85 50
upstream ENSMUSE00000638595 Chr2:180423529..180424360 AAAAAGAATGTGCCGGTGTC Chr2:180424090..180424109 59.98 45
upstream ENSMUSE00000720765 Chr2:180423529..180424360 AAAAAGAATGTGCCGGTGTC Chr2:180424090..180424109 59.98 45
upstream ENSMUSE00000638594 Chr2:180422181..180422502 TTTTGCAAGTGCAGGATGAG Chr2:180422361..180422380 59.99 45
upstream ENSMUSE00000638593 Chr2:180419669..180419881 CTCCTGGTGCTCCTAAATGC Chr2:180419852..180419871 59.84 55
upstream ENSMUSE00000638592 Chr2:180418514..180418733 CGCCCACCCTATTGAGTAAA Chr2:180418515..180418534 59.95 50
upstream ENSMUSE00000661131 Chr2:180418254..180418733 CCTCATGTTGGAGGCAATTT Chr2:180418280..180418299 59.93 45
upstream ENSMUSE00000661132 Chr2:180415763..180418733 GAAACCCGGGAGTGTAGTCA Chr2:180416823..180416842 59.97 55
upstream ENSMUSE00000638591 Chr2:180409673..180410132 TACCATCCCGAAGAAAGCAC Chr2:180410067..180410086 60.07 50
upstream ENSMUSE00000678345 Chr2:180409673..180410660 TACCATCCCGAAGAAAGCAC Chr2:180410067..180410086 60.07 50
upstream ENSMUSE00000638590 Chr2:180409396..180409555 GAGCAAATATCGCAGCATCA Chr2:180409425..180409444 59.94 45
upstream ENSMUSE00000638589 Chr2:180408180..180408296 GGCTCTTCCATCGTGTTCTT Chr2:180408276..180408295 59.29 50

*** Putative Vector Insertion (Chr 2: 180408179 - 180409556) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638588 Chr2:180407936..180408040 CGGTGGAGAATCTTCCATGT Chr2:180407929..180407948 59.93 50
downstream ENSMUSE00000638587 Chr2:180406988..180407123 TGAAGACGTCCAGGAGAGGT Chr2:180407038..180407057 59.83 55
downstream ENSMUSE00000638586 Chr2:180406097..180406619 GTATGGACTTGGGCACCACT Chr2:180406133..180406152 59.85 55
downstream ENSMUSE00000638585 Chr2:180405566..180405719 TTCCAAATCGTGTTGAGTCG Chr2:180405626..180405645 59.69 45
downstream ENSMUSE00000638584 Chr2:180404970..180405059 CGTAATCCCACACGGTCTTT Chr2:180404977..180404996 59.85 50
downstream ENSMUSE00000546157 Chr2:180404096..180404291 CTCAAAGGGCAAGAGTTTGG Chr2:180404081..180404100 59.85 50
downstream ENSMUSE00000661133 Chr2:180404070..180404291 CTCAAAGGGCAAGAGTTTGG Chr2:180404081..180404100 59.85 50
downstream ENSMUSE00000678344 Chr2:180402995..180404291 AGTAGAAGGCACCCCTGGAT Chr2:180403725..180403744 59.96 55
downstream ENSMUSE00000661135 Chr2:180402993..180404291 AGTAGAAGGCACCCCTGGAT Chr2:180403725..180403744 59.96 55
downstream ENSMUSE00000224519 Chr2:180392669..180397288 CTCCGAAGAACAAACGAAGC Chr2:180393012..180393031 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr2:180409488..180409508 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGTCAATGACAGCGATGA Chr2:180409536..180409557 60 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038914