Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31655
Trapped Gene
Parva (ENSMUSG00000030770)
Vector Insertion
Chr 7: 119571615 - 119663214
Public Clones IST12805E1 (tigm) IST13533H9 (tigm) IST11847D3 (tigm) IST10426H7 (tigm)
IST12296G9 (tigm) IST14571C1 (tigm) IST13007A9 (tigm) IST11043B1 (tigm)
IST14069E9 (tigm) IST14069E10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520285 (Chr7:119571220..119571614 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGACTCGTTCTTGGGGAAAC Chr7:119571556..119571575 60.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520285 (Chr7:119571220..119571614 +)
Downstram Exon
ENSMUSE00000670737 (Chr7:119663215..119663342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGACTCGTTCTTGGGGAAAC Chr7:119571556..119571575 60.09 50 TCAGGACAGCCTTCTGAGGT Chr7:119663241..119663260 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670743 Chr7:119571019..119571044 ATAGGAACCCATCCATGCAG Chr7:119571022..119571041 59.77 50
upstream ENSMUSE00000520285 Chr7:119571220..119571614 TGACTCGTTCTTGGGGAAAC Chr7:119571556..119571575 60.09 50
upstream ENSMUSE00000670742 Chr7:119571415..119571614 TGACTCGTTCTTGGGGAAAC Chr7:119571556..119571575 60.09 50

*** Putative Vector Insertion (Chr 7: 119571615 - 119663214) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000670737 Chr7:119663215..119663342 TCAGGACAGCCTTCTGAGGT Chr7:119663241..119663260 59.99 55
downstream ENSMUSE00000303522 Chr7:119687691..119687780 GTTGATGGCGTTCATTCCTT Chr7:119687731..119687750 59.94 45
downstream ENSMUSE00000203073 Chr7:119688247..119688317 CATTGTCCGGACCTCATTCT Chr7:119688272..119688291 59.93 50
downstream ENSMUSE00000203068 Chr7:119691025..119691127 CGAGGTCCTTCACGATGATT Chr7:119691088..119691107 60.07 50
downstream ENSMUSE00000203061 Chr7:119703443..119703583 CTTCTGTTTCTGGGCGATCT Chr7:119703513..119703532 59.43 50
downstream ENSMUSE00000203055 Chr7:119711277..119711392 GTGCCCGGAAATATTGAGAC Chr7:119711348..119711367 59.39 50
downstream ENSMUSE00000203071 Chr7:119716385..119716443 CTGGAGGATCCCTTCTCGTT Chr7:119716408..119716427 60.59 55
downstream ENSMUSE00000670752 Chr7:119718869..119718888 No primer for this exon
downstream ENSMUSE00000203069 Chr7:119719914..119719975 ATGGTCAAACAGCGTGTCAA Chr7:119719948..119719967 60.16 45
downstream ENSMUSE00000203075 Chr7:119720450..119720518 No primer for this exon
downstream ENSMUSE00000203067 Chr7:119723170..119723271 GCTGTGCAGGGGTACAAAGT Chr7:119723241..119723260 60.18 55
downstream ENSMUSE00000203065 Chr7:119724464..119724536 ATGAGCTCAAAGGCAAAGGA Chr7:119724498..119724517 59.96 45
downstream ENSMUSE00000401341 Chr7:119732054..119732484 TCCTATGTTCAGGGGGACTG Chr7:119732449..119732468 59.92 55
downstream ENSMUSE00000471145 Chr7:119732054..119735202 CATGTGAAGTGAGGGGTCCT Chr7:119733822..119733841 59.96 55
downstream ENSMUSE00000670740 Chr7:119732054..119733143 TCCTATGTTCAGGGGGACTG Chr7:119732449..119732468 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr7:119598663..119598683 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr7:119598662..119598682 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030770