Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31660
Trapped Gene
Acbd5 (ENSMUSG00000026781)
Vector Insertion
Chr 2: 22950038 - 22955084
Public Clones IST10294C7 (tigm) IST12488E4 (tigm) IST11916H7 (tigm) IST12288H6 (tigm)
IST14746C12 (tigm) IST12288H6 (tigm) IST13922B4 (tigm) IST14177E2 (tigm)
IST13572B8 (tigm) IST11736D12 (tigm) IST10018A9 (tigm) IST12045G8 (tigm)
IST12045G8 (tigm) IST14817D8 (tigm) IST14286C2 (tigm) IST10374A4 (tigm)
IST14440B1 (tigm) IST14440B1 (tigm) IST11801A12 (tigm) IST11704G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000270709 (Chr2:22949809..22950037 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCGAGGACTTCTCCAGTG Chr2:22950003..22950022 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000270709 (Chr2:22949809..22950037 +)
Downstram Exon
ENSMUSE00000270696 (Chr2:22955085..22955284 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCGAGGACTTCTCCAGTG Chr2:22950003..22950022 60.13 60 GTCCTTCGCTCAAATGTGGT Chr2:22955117..22955136 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699659 Chr2:22923688..22923806 GTCGAGACAAAACGGACAGG Chr2:22923760..22923779 60.69 55
upstream ENSMUSE00000699654 Chr2:22923770..22923806 CCTTGCCAGTCATTTGGCTA Chr2:22923780..22923799 61.16 50
upstream ENSMUSE00000699668 Chr2:22924588..22924804 CAAGGCCTGCTGCTAGAGAT Chr2:22924772..22924791 59.74 55
upstream ENSMUSE00000699705 Chr2:22924599..22924804 CAAGGCCTGCTGCTAGAGAT Chr2:22924772..22924791 59.74 55
upstream ENSMUSE00000374754 Chr2:22924971..22925139 CCAGAGTTTGCCGAAAAATG Chr2:22925120..22925139 60.61 45
upstream ENSMUSE00000699658 Chr2:22924971..22925139 CCAGAGTTTGCCGAAAAATG Chr2:22925120..22925139 60.61 45
upstream ENSMUSE00000709654 Chr2:22931010..22931130 GGCAACTGAAGGACCCTGTA Chr2:22931065..22931084 60.11 55
upstream ENSMUSE00000719858 Chr2:22931010..22931130 GGCAACTGAAGGACCCTGTA Chr2:22931065..22931084 60.11 55
upstream ENSMUSE00000162672 Chr2:22933664..22933736 GCCATGATTGCATATGTTGAA Chr2:22933704..22933724 59.4 38.1
upstream ENSMUSE00000699651 Chr2:22933664..22933736 GCCATGATTGCATATGTTGAA Chr2:22933704..22933724 59.4 38.1
upstream ENSMUSE00000162678 Chr2:22935859..22935973 ATTGAAACCATGCCCATGAC Chr2:22935862..22935881 60.59 45
upstream ENSMUSE00000699648 Chr2:22935859..22935973 ATTGAAACCATGCCCATGAC Chr2:22935862..22935881 60.59 45
upstream ENSMUSE00000162682 Chr2:22943005..22943139 TGAAGAAGAAGAGGCCCAAG Chr2:22943084..22943103 59.54 50
upstream ENSMUSE00000699647 Chr2:22943005..22943139 TGAAGAAGAAGAGGCCCAAG Chr2:22943084..22943103 59.54 50
upstream ENSMUSE00000699683 Chr2:22943005..22943138 TGAAGAAGAAGAGGCCCAAG Chr2:22943084..22943103 59.54 50
upstream ENSMUSE00000699679 Chr2:22945110..22945308 ACCATTGTCTGTGCTCACCA Chr2:22945287..22945306 60.16 50
upstream ENSMUSE00000162680 Chr2:22945111..22945308 ACCATTGTCTGTGCTCACCA Chr2:22945287..22945306 60.16 50
upstream ENSMUSE00000699646 Chr2:22945111..22945156 AAACGCTGAAGAAATCAGCA Chr2:22945117..22945136 58.65 40
upstream ENSMUSE00000162676 Chr2:22945996..22946102 TGGAGCAATTTGGACAAGAA Chr2:22946080..22946099 59.25 40
upstream ENSMUSE00000270709 Chr2:22949809..22950037 GAGCGAGGACTTCTCCAGTG Chr2:22950003..22950022 60.13 60

*** Putative Vector Insertion (Chr 2: 22950038 - 22955084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699673 Chr2:22955082..22955284 GTCCTTCGCTCAAATGTGGT Chr2:22955117..22955136 60.12 50
downstream ENSMUSE00000270696 Chr2:22955085..22955284 GTCCTTCGCTCAAATGTGGT Chr2:22955117..22955136 60.12 50
downstream ENSMUSE00000270685 Chr2:22965765..22965806 GAGGGCTGATTACTTGTCTGC Chr2:22965801..22965821 58.95 52.38
downstream ENSMUSE00000331792 Chr2:22966174..22966283 ACAAATGTGCCAACCACTGA Chr2:22966267..22966286 60.01 45
downstream ENSMUSE00000699656 Chr2:22968025..22970030 AAGCGCAGTACAAGGACGAT Chr2:22968624..22968643 59.9 50
downstream ENSMUSE00000699660 Chr2:22968025..22970028 AAGCGCAGTACAAGGACGAT Chr2:22968624..22968643 59.9 50
downstream ENSMUSE00000699669 Chr2:22968025..22969935 AAGCGCAGTACAAGGACGAT Chr2:22968624..22968643 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCGAGGACTTCTCCAGTG Chr2:22953004..22953024 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCGAGGACTTCTCCAGTG Chr2:22953004..22953024 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026781