Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31662
Trapped Gene
Nanog (ENSMUSG00000012396)
Vector Insertion
Chr 6: 122662734 - 122663159
Public Clones IST13211H6 (tigm) IST12240H12 (tigm) IST12240H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000283716 (Chr6:122662647..122662733 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000283716 (Chr6:122662647..122662733 +)
Downstram Exon
ENSMUSE00000692317 (Chr6:122663160..122663288 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692315 Chr6:122657507..122657534 No primer for this exon
upstream ENSMUSE00000692312 Chr6:122657583..122657626 No primer for this exon
upstream ENSMUSE00000283734 Chr6:122657611..122657951 No primer for this exon
upstream ENSMUSE00000692314 Chr6:122657830..122657951 No primer for this exon
upstream ENSMUSE00000197495 Chr6:122661556..122661821 No primer for this exon
upstream ENSMUSE00000283716 Chr6:122662647..122662733 No primer for this exon

*** Putative Vector Insertion (Chr 6: 122662734 - 122663159) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000283708 Chr6:122663160..122664651 No primer for this exon
downstream ENSMUSE00000692313 Chr6:122663160..122664650 No primer for this exon
downstream ENSMUSE00000692317 Chr6:122663160..122663288 No primer for this exon
downstream ENSMUSE00000692316 Chr6:122663319..122663573 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCCTCCATCTTACCATCT Chr6:122662766..122662786 60.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCATCCGTGACTGGGAAA Chr6:122662778..122662798 61.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000012396