Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31666
Trapped Gene
Myo1f (ENSMUSG00000024300)
Vector Insertion
Chr 17: 33735258 - 33737995
Public Clones (sanger) IST14349E2 (tigm) IST12015C9 (tigm) IST10983H4 (tigm) IST13169F1 (tigm)
IST11629E3 (tigm) IST10067E11 (tigm) IST13829G8 (tigm) IST10960H6 (tigm)
IST14931A11 (tigm) IST14252B1 (tigm) IST12015C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000546748 (Chr17:33735088..33735257 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGGACTTTGCCGACTCAG Chr17:33735212..33735231 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000546748 (Chr17:33735088..33735257 +)
Downstram Exon
ENSMUSE00000140687 (Chr17:33737996..33738141 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGGACTTTGCCGACTCAG Chr17:33735212..33735231 60.44 55 CGCACTAGACCCTTCTCTGG Chr17:33738090..33738109 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699210 Chr17:33692664..33692801 GAGGAACTAGGGCCAAGAGC Chr17:33692682..33692701 60.35 60
upstream ENSMUSE00000331991 Chr17:33712736..33712873 ACTGGCAGAGTCACAACGTG Chr17:33712755..33712774 59.94 55
upstream ENSMUSE00000140680 Chr17:33713379..33713468 CCTTCAAGCAGATGCCCTAC Chr17:33713413..33713432 59.84 55
upstream ENSMUSE00000546776 Chr17:33713558..33713652 CTCACCGACAACATGTACCG Chr17:33713591..33713610 60.03 55
upstream ENSMUSE00000400959 Chr17:33715038..33715125 CATCATGGGCTACATCTCCA Chr17:33715077..33715096 59.48 50
upstream ENSMUSE00000546771 Chr17:33715205..33715294 CAGTCAAACCCACTGCTTGA Chr17:33715226..33715245 59.87 50
upstream ENSMUSE00000546769 Chr17:33716812..33716943 GTTCAGTCGAGGTGGAGAGC Chr17:33716832..33716851 59.99 60
upstream ENSMUSE00000430762 Chr17:33717104..33717238 AAGGCACTGATGACCGAAGT Chr17:33717201..33717220 59.73 50
upstream ENSMUSE00000430749 Chr17:33718903..33719035 No primer for this exon
upstream ENSMUSE00000395069 Chr17:33719185..33719381 ACCAGCCGTAAGATGGACAG Chr17:33719244..33719263 60.13 55
upstream ENSMUSE00000140670 Chr17:33720630..33720710 ATGCAGAAGCCTCAGGAAGA Chr17:33720645..33720664 60.1 50
upstream ENSMUSE00000546764 Chr17:33720835..33720921 TATTGAGCTCACGCTGAAGG Chr17:33720894..33720913 59.17 50
upstream ENSMUSE00000305523 Chr17:33722538..33722624 GACCCCCATCGAATACTTCA Chr17:33722567..33722586 59.75 50
upstream ENSMUSE00000546729 Chr17:33723061..33723228 GGGTTTCGTCATCCATCACT Chr17:33723198..33723217 59.79 50
upstream ENSMUSE00000657679 Chr17:33725048..33725133 GGCTTCTGTGAGAGGAATCG Chr17:33725066..33725085 59.95 55
upstream ENSMUSE00000657678 Chr17:33727773..33727854 CCTACGGATGCTCTTTCCTG Chr17:33727779..33727798 59.83 55
upstream ENSMUSE00000546754 Chr17:33729866..33729972 GAAGTGCACACCCCACTACA Chr17:33729898..33729917 59.6 55
upstream ENSMUSE00000372513 Chr17:33730966..33731064 GTCGGCAGTTCTCCAAATTC Chr17:33731037..33731056 59.68 50
upstream ENSMUSE00000402427 Chr17:33731168..33731312 CTGCTTCGTGCTGTCAACAT Chr17:33731235..33731254 60.06 50
upstream ENSMUSE00000140678 Chr17:33734886..33735000 GCTCGCACTATCCAGAAAGC Chr17:33734931..33734950 60.12 55
upstream ENSMUSE00000546748 Chr17:33735088..33735257 AGTGGACTTTGCCGACTCAG Chr17:33735212..33735231 60.44 55

*** Putative Vector Insertion (Chr 17: 33735258 - 33737995) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000140687 Chr17:33737996..33738141 CGCACTAGACCCTTCTCTGG Chr17:33738090..33738109 60.01 60
downstream ENSMUSE00000140672 Chr17:33738604..33738750 CTCTTCAAAACGCTTGCACA Chr17:33738715..33738734 60.17 45
downstream ENSMUSE00000140684 Chr17:33738887..33739035 CTTTCTTCACCCGGAACTGT Chr17:33738912..33738931 59.18 50
downstream ENSMUSE00000140681 Chr17:33739471..33739554 No primer for this exon
downstream ENSMUSE00000699190 Chr17:33739471..33739535 No primer for this exon
downstream ENSMUSE00000699188 Chr17:33739538..33739554 No primer for this exon
downstream ENSMUSE00000699187 Chr17:33739673..33739695 No primer for this exon
downstream ENSMUSE00000140662 Chr17:33741202..33741397 GGTACCCCATTTCGATTCAA Chr17:33741226..33741245 59.62 45
downstream ENSMUSE00000699185 Chr17:33741202..33741254 GGTGGTACCCCATTTCGATT Chr17:33741229..33741248 60.81 50
downstream ENSMUSE00000699181 Chr17:33741272..33741316 No primer for this exon
downstream ENSMUSE00000699180 Chr17:33741318..33741397 CCCTGGTCAGGCACATTAAG Chr17:33741391..33741410 60.51 55
downstream ENSMUSE00000140665 Chr17:33741495..33741664 No primer for this exon
downstream ENSMUSE00000546724 Chr17:33744244..33744703 CTGGGAGGTAGGTTTTGCAG Chr17:33744572..33744591 59.73 55
downstream ENSMUSE00000707337 Chr17:33744244..33744320 CTTCCACCAGCCAGAAGAGT Chr17:33744266..33744285 59.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGAATAATCGCCTTGCAG Chr17:33735303..33735323 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGAACGTGACTGGGAAAA Chr17:33735303..33735323 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024300