Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31671
Trapped Gene
Kcnk3 (ENSMUSG00000049265)
Vector Insertion
Chr 5: 30890973 - 30924263
Public Clones IST11297C6 (tigm) IST11049H12 (tigm) IST15013H9 (tigm) IST11541G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601675 (Chr5:30890543..30890972 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTCATCGTGTGCACCTTC Chr5:30890718..30890737 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601675 (Chr5:30890543..30890972 +)
Downstram Exon
ENSMUSE00000655056 (Chr5:30924264..30927643 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTCATCGTGTGCACCTTC Chr5:30890718..30890737 59.42 55 TCCAGCCCAACATAAACACA Chr5:30927225..30927244 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601675 Chr5:30890543..30890972 CTCTCATCGTGTGCACCTTC Chr5:30890718..30890737 59.42 55

*** Putative Vector Insertion (Chr 5: 30890973 - 30924263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655056 Chr5:30924264..30927643 TCCAGCCCAACATAAACACA Chr5:30927225..30927244 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATCAGCATAATCGCCTTGC Chr5:30918016..30918036 60.2 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCACCGTCATCACCACCAT Chr5:30923952..30923972 61.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049265