Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI31672
Trapped Gene
OTTMUSG00000016327 (ENSMUSG00000078862)
Vector Insertion
Chr 2: 177683141 - 177688442
Public Clones (ggtc) (ggtc) (ggtc) IST12144C8 (tigm) IST14388D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710903 (Chr2:177688387..177688441 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGATGCTGTGAATTTAGC Chr2:177688414..177688434 59.87 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710903 (Chr2:177688387..177688441 -)
Downstram Exon
ENSMUSE00000638705 (Chr2:177683142..177683268 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGATGCTGTGAATTTAGC Chr2:177688414..177688434 59.87 47.62 TCACCTGCACATCATCATAGG Chr2:177683216..177683236 59.54 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678533 Chr2:177691913..177691944 No primer for this exon
upstream ENSMUSE00000678545 Chr2:177691913..177692056 CTGTAACTCAGCGGTCATGG Chr2:177691993..177692012 59.31 55
upstream ENSMUSE00000678548 Chr2:177691913..177691993 TGTGATGTGTTCTGCGTGAC Chr2:177691964..177691983 59.27 50
upstream ENSMUSE00000678547 Chr2:177688387..177688441 GCTGGATGCTGTGAATTTAGC Chr2:177688414..177688434 59.87 47.62
upstream ENSMUSE00000710903 Chr2:177688387..177688441 GCTGGATGCTGTGAATTTAGC Chr2:177688414..177688434 59.87 47.62
upstream ENSMUSE00000638705 Chr2:177683142..177683268 ACTTCACTCGGGATGAGTGG Chr2:177683218..177683237 60.11 55

*** Putative Vector Insertion (Chr 2: 177683141 - 177688442) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638704 Chr2:177682875..177682935 No primer for this exon
downstream ENSMUSE00000678532 Chr2:177682383..177682935 GAGACTCGCCCTTGTACAGC Chr2:177682581..177682600 60.02 60
downstream ENSMUSE00000678535 Chr2:177681891..177681892 No primer for this exon
downstream ENSMUSE00000678534 Chr2:177681766..177681779 No primer for this exon
downstream ENSMUSE00000678544 Chr2:177681393..177681715 AACTCAGAGGGTTGCTCTGC Chr2:177681655..177681674 59.6 55
downstream ENSMUSE00000678538 Chr2:177681360..177681810 AACTCAGAGGGTTGCTCTGC Chr2:177681655..177681674 59.6 55
downstream ENSMUSE00000678537 Chr2:177680639..177680771 TGTTGGTCACCACTTCTTGC Chr2:177680689..177680708 59.73 50
downstream ENSMUSE00000678536 Chr2:177680242..177680470 TCCGGAATGTGTCCGTTTAT Chr2:177680328..177680347 60.19 45
downstream ENSMUSE00000678541 Chr2:177680242..177681715 TCGGAGATGACTGCTTTGTG Chr2:177680268..177680287 59.98 50
downstream ENSMUSE00000678542 Chr2:177679698..177679715 No primer for this exon
downstream ENSMUSE00000678546 Chr2:177670698..177671261 CAGCAATGATGTCCCAACAC Chr2:177670973..177670992 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACCATCTACCCCAGCAAT Chr2:177688471..177688491 60.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACCATCTACCCCAGCAAT Chr2:177688471..177688491 60.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078862